                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:98 nt.    Distance to gene:58 nt.     Distance to run of Ts=3 nt.   Size=22 nt.     Delta G= -6.70 kcal/mol
Antiterminator:    Distance from promoter:75 nt. Size=30 nt.     Delta G= -4.20 kcal/mol
Anti-antiterminator:    Distance from promoter:51 nt.    Size=41 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttgtt-taaaat. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttgtttctcttggaaaagatagtaaaatcagcagattatgaaacagaatgatggttttcttatagaagccatttttcttttttgagcaggtagaaagac
tcaacgtatttatctttaagagaaagagactacgctaatagcagtagttgtatttatttgtgattttgcacaaattttttgtgcatttataatactcatg
atttgaggggtgaagcagTTG

    BC0122 --- BC0123 Gene: BC0122     GI: 30018372     BI number: BC0122     GOG: COG0085     Description: DNA-directed RNA polymerase beta chain Gene: BC0123     GI: 30018373     BI number: BC0123     GOG: COG0086     Description: DNA-directed RNA polymerase beta' chai   a c  a t  c cg at g  a a  | a  |        g at       a  a gt       a  g at        ta ta        ta         a gt        ta       a  t gc        cg       t  a at        ta        cg c  |      a  g       gc g  |      t  a      |  a at       t  c       cg gt       t  |       at ta        at        ta ta        ta        cg tg        gc        at ta        cg        gt                         gtatttatttgtgattttgcacaaattttttgtgcatttataatactcatgatttgaggggtgaagcagTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0085 DNA-directed RNA polymerase, beta subunit/140 kD subunit ... can be seen here [K] COG0086 DNA-directed RNA polymerase, beta' subunit/160 kD subunit ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC14579                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:135 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-11.10 kcal/mol Antiterminator: Size=40 nt.     Delta G= -3.06 kcal/mol Anti-antiterminator:   Size=52 nt.     Delta G= -4.89 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AAAACGTTGAcggttatttttggctatgttaacattatacaatgccaatatatgattttctgcgttgagaaagatgtatatttttgtttctct tggaaaagatagtaaaatcagcagattatgaaacagaatgatggttttcttatagaagccatttttcttttttgagcaggtagaaagactcaacgtattt atctttaagagaaagagactacgctaatagcagtagttgtatttatttgtgattttgcacaaattttttgtgcatttataatactcatgatttgaggggt gaagcagTTG     BC0122 --- BC0123 Gene: BC0122     GI: 30018372     BI number: BC0122     GOG: COG0085     Description: DNA-directed RNA polymerase beta chain Gene: BC0123     GI: 30018373     BI number: BC0123     GOG: COG0086     Description: DNA-directed RNA polymerase beta' chai ct t  t cg tg ta t  | g  | ta ta         a ta       g  a tg       t  a ta       a  c at       t  a       ta ta       t  g      t  t a  g      a  a      c  a t  t      g  a       tg g  a       at        ta t  a       cg        ta a  a      g  a       tg g  a       at        gc a  |       cg        gc a  |       tg        ta a  |       at        at g  |       at        gt at        at       t  t gc        at        at ta       t  |       at tg        gc        gc gc        at        at                         tttttgagcaggtagaaagactcaacgtatttatctttaagagaaagagactacgctaatagcagtagttgtatttatttgtgattttgcacaaattttttgtgcatttataatactcatgatttgaggggtgaagcagTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0085 DNA-directed RNA polymerase, beta subunit/140 kD subunit ... can be seen here [K] COG0086 DNA-directed RNA polymerase, beta' subunit/160 kD subunit ... can be seen here     ..................................................................................................................