                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:182 nt.    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -9.90 kcal/mol
Antiterminator:    Distance from promoter:166 nt. Size=27 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:    Distance from promoter:146 nt.    Size=31 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgagt-taacat. It has a score value of 83 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgagtaattgttttattttttgtaacatttcatcttttttgatagactaataatagagatatatcaaaaggaggcaaagactcaatatgtggaggaact
tgtaatgattagaaactagatagatgaatttttctctcataagcgagggtttatttagttatctgtaaatcattcaaggaatgcatatttggcttgtaca
tcccttttataaggataggtgcctattttatgtatctgtcttttttgtgggaaagtttatatctcttatataaaatATG

    BC0195 Gene: BC0195     GI: 30018432     BI number: BC0195     GOG: COG1028     Description: 3-oxoacyl-[acyl-carrier protein] reductas   g                   t t  g                t  t t  c       ta       a  t t  t      t  t      t  a at        ta       c  t tg        ta        cg at        cg        gt c  a       cg        ta gc       |  a       gt ta       c  t       gc at       t  a       at a  c      a  g       tg gc        cg        at gc        at        gc at        tg        gt at        gc        at                         ttttgtgggaaagtttatatctcttatataaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here     ..................................................................................................................