                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:166 nt.    Distance to gene:29 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-16.30 kcal/mol
Antiterminator:    Distance from promoter:138 nt. Size=42 nt.     Delta G=-11.40 kcal/mol
Anti-antiterminator:    Distance from promoter:132 nt.    Size=31 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tactat. It has a score value of 78.98 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaattctttttgtacgatttactattagtaccatattcaaaactacatacacatactcttatcaagagtggcggagggactggcccgatgatgccc
ggcaaccgagcttatgacgtataagctaaggtgctaattcctgcaaaacgagttttcgttttggaagataagagaggaatctatttcgtctattcggcac
ctctcttattttttgggaggtgctttttattttggaacgtatatgaagggggatttatagATG

    BC0198 --- BC0197 --- BC0196 Gene: BC0198     GI: 30018435     BI number: BC0198     GOG: COG1464     Description: ABC transporter substrate-binding protein Gene: BC0197     GI: 30018434     BI number: BC0197     GOG: COG1135     Description: ABC transporter ATP-binding protein Gene: BC0196     GI: 30018433     BI number: BC0196     GOG: COG2011     Description: ABC transporter permease protei             t           a  t           t  c            cg            tg            gc           c  a           t  |           t  |           t  | ga       a  | g  a      t  |        t at       c  |      t  t gc       t  |      a  t at       a  |      t  t g  a      a  |      t  t a  t       gc        cg a  t       gc        tg t  |       at        cg at        gc        ta gc        at        cg a  g       gc        cg at        at        at gc        at        cg gt        ta        gc ta        at        gt                         ttttattttggaacgtatatgaagggggatttatagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1464 ABC-type metal ion transport system, periplasmic component/surface antigen ... can be seen here [P] COG1135 ABC-type metal ion transport system, ATPase component ... can be seen here [P] COG2011 ABC-type metal ion transport system, permease component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................