                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:100 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-11.70 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -3.90 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-14.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACAATCGTGTACGTACTTTTAGAGAATGAACAAAAGGTATTTATGATACCGGTGAAGA
AATTCCCATATGCTATGTTTACAGAAGTAGGAGACCCAATTCAAATTACATATTTAGA
TACGGGAGAGATGATGTCCTCAGTATCTAAATTTACGAATAGCAATGTGAAAAAGTAA
agcgatagaatttctatcgctttttttacattatgaaagaggaaaatgcgctgtacttgacgtatgtttatgatgtaactataattgttacgattcagtt
tgtataggaaagggtgaattgaaaaaGTG

    BC0204 Gene: BC0204     GI: 30018441     BI number: BC0204     GOG: COG0477     Description: Bicyclomycin resistance protei            CA           G  A            AT   A        TG G  T       AT TG       |  G AT       |  A GC       |  A A  |      |  A GC       A  A AT       G  A GC        CG G  A       AT         t G  |       TA       a  t CG        TA       a  t AT        Ta        gc TA       |  g       at AT       |  c       ta GC       A  g       at AT       A  a       gc TA        At        cg TA        Ta        gc TA        Cg        at AT        Ta        At                         tttttacattatgaaagaggaaaatgcgctgtacttgacgtatgtttatgatgtaactataattgttacgattcagtttgtataggaaagggtgaattgaaaaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................