                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:49 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-17.30 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -8.00 kcal/mol
Anti-antiterminator:   Size=18 nt.     Delta G= -3.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

caaggtgtaagattttgaattatcaaagaaacacaaaaattaataaaatttattcgtttactcattgtatcaagagaggtggagggactggccctttgaa
acctcggcaacaggttcattttgaatactgtgccacttcctgcaagctttatgcttgaaagatagaatgagggacttcgtttatatacgggtgcataact
tgtacgtaaaaatccctctttctcaatatgaaaagagggattttttatttttcatttccctcatcatcatccaaacttaattatttaggaggaaaatcaa
ATG

    BC0216 Gene: BC0216     GI: 30018453     BI number: BC0216     GOG: COG4166     Description: Oligopeptide-binding protein opp                       t                     a  a                     a  t                      cg             a        ta           c  t      c  |           g  a       ta            ta        ta            gc        ta            gt        cg            gt        ta ga        cg        cg g  c       at        cg gt        ta        cg at       a  c       ta gc       t  g       at tg        at        at at        ta        at at        ta        at gt        ta        at                         tatttttcatttccctcatcatcatccaaacttaattatttaggaggaaaatcaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG4166 ABC-type oligopeptide transport system, periplasmic component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC14579 This operon is putativelly rgulated by Methionine_S-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:56 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-12.60 kcal/mol Antiterminator: Size=60 nt.     Delta G=-21.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case caaggtgtaagattttgaattatcaaagaaacacaaaaattaataaaatttattcgtttactcattgtatcaagagaggtggagggactggccctttgaa acctcggcaacaggttcattttgaatactgtgccacttcctgcaagctttatgcttgaaagatagaatgagggacttcgtttatatacgggtgcataact tgtacgtaaaaatccctctttctcaatatgaaaagagggattttttatttttcatttccctcatcatcatccaaacttaattatttaggaggaaaatcaa ATG     BC0216 Gene: BC0216     GI: 30018453     BI number: BC0216     GOG: COG4166     Description: Oligopeptide-binding protein opp   a c  t g  a ta gc gt gt cg at ta a  c t  g at ta ta ta g  a c  a        t t  |      a  a t  |      a  t c  |       cg at        ta gc       c  | gc        ta gc        ta at        ta gc        cg t  t       ta at        cg at        cg gc        cg at        ta             ttttttatttttcatttccctcatcatcatccaaacttaattatttaggaggaaaatcaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG4166 ABC-type oligopeptide transport system, periplasmic component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................