Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:112 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-14.10 kcal/mol
Antiterminator: Size=75 nt.     Delta G= -7.03 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -3.22 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAAAGGGGAAAAAGGCACAATTGATTTTTGGAGATCCAATTCAAATTGAGGCTGGAGA
ACAAATAGATCGAAAAACCGCTATGAAAATGATGACGGATCAATTAAATGAGAAGTTT
GAGGAGTTAAAAGAAGCTTTGCAATCAAATCAAAAATAAgaaaagacgaccgggcatagacggtcgtcttt
tctattactatttataataaaggggaaaggggacacaaagttatacaagcgtagcggcgtaaataaaagcagtaagaagaatcgagccactagctagtcc
taaaaaatctaatTTG

    BC0229


Gene: BC0229     GI: 30018466     BI number: BC0229     GOG: -------     Description: hypothetical protei


            A
          A  G
           GC
           AT
           AT
           AT
          A  G
          T  C
          T  A
          G  A
           AT
           GC
          |  A
          |  A
          G  A
           AT
           GC
           TA
           TA
           TA
          G  A
          A  A
  G       A  T
T  A      G  A
A  G      A  A
A  A      G  g
A  A      T  a
T  G      A  a
T  T      A  a       at
 AT       A  a      c  a
 AT       T  g      g  g
 CG       T  a      g  a
 TA       A  c       gc
A  G      A  |       cg
G  G       Cg        cg
G  A       Ta        at
 CG       A  |       gc
 AT        Gc        cg
 GT        Gc        at
 TA        Cg        gc
                        ttttctattactatttataataaaggggaaaggggacacaaagttatacaagcgtagcggcgtaaataaaagcagtaagaagaatcgagccactagctagtcctaaaaaatctaatTTG


    ..................................................................................................................