                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:92 nt.    Distance to gene:107 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-14.80 kcal/mol
Antiterminator:    Distance from promoter:62 nt. Size=43 nt.     Delta G= -8.22 kcal/mol
Anti-antiterminator:    Distance from promoter:31 nt.    Size=45 nt.     Delta G=-11.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTTA-TAAGTT. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTTATTAATAAACAAGAGCTTGTTAAGTTAAAACAAGTTATTAGCCGGGTAGATGA
AGATGCTTTCGTTGTTATACATGATGTACGTGATGTACTTGGCGGTGGCTTTAAAGCA
AGCTAAaaggtgaacgagtaaattcgttcaccttttttaattcttacaaaaatgtaagtgtaatgtaatgagattcaatagtagattttattcccc
ctttttaaaatggatgtatatatatcctgcagaggaggaatgtttattATG

    BC0233 Gene: BC0233     GI: 30018470     BI number: BC0233     GOG: COG5294     Description: hypothetical protei            AA TA       A  G G  C      T  C TG        TA AT        TA G  G       CG TA        GC AT        GT CG        TA AT       |  A TA       |  a A  C      |  a       aa T  T      |  g      t  a T  |      |  g       gt GT       G  t       at TG       G  g       gc TG       C  a       cg GC       G  a       at CG        Gc        at TG        Tg        gc T  T       Ta        ta TG        Cg        gc CG        At        gc GC        Ta        at                         tttttaattcttacaaaaatgtaagtgtaatgtaatgagattcaatagtagattttattccccctttttaaaatggatgtatatatatcctgcagaggaggaatgtttattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5294 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................