                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:14 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-15.60 kcal/mol
Antiterminator: Size=76 nt.     Delta G=-11.49 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cttttttaaaccttacaacattgtaaggtttacgtaagttaattcgatagtaaatttgtcatattttttgcataatagatacagatagaaaaataattag
ggatctagtaagaagggagaaaaatgggatgcgtaaagaagaagtagtgaagttaccaattaaagatttctgtagctactttactgttgccgtagtgtgt
attggattatttgatatcataacaaacttaattgttaaataatatagatgctaaaacaagaaaggaagtcctttcttgttttttttatgggggcataaag
ATG

    BC0234 Gene: BC0234     GI: 30018471     BI number: BC0234     GOG: COG0084     Description: Sec-independent secretion Tat aa c  a a  c a  t t  t a  a c  a t  t at tg at gt ta ta ta at ta ta at |  a g  t g  a tg ta at tg gc        ag |  t      a  t |  a       gc |  a       gc |  a       at ta        at gc        at ta        gc |  a       at g  g       at a  a       cg t  a       at g  a       at cg        at cg        at             ttttatgggggcataaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0084 Mg-dependent DNase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC14579                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:21 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -6.10 kcal/mol Antiterminator: Size=76 nt.     Delta G=-11.49 kcal/mol Anti-antiterminator:   Size=51 nt.     Delta G= -6.39 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case cttttttaaaccttacaacattgtaaggtttacgtaagttaattcgatagtaaatttgtcatattttttgcataatagatacagatagaaaaataattag ggatctagtaagaagggagaaaaatgggatgcgtaaagaagaagtagtgaagttaccaattaaagatttctgtagctactttactgttgccgtagtgtgt attggattatttgatatcataacaaacttaattgttaaataatatagatgctaaaacaagaaaggaagtcctttcttgttttttttatgggggcataaag ATG     BC0234 Gene: BC0234     GI: 30018471     BI number: BC0234     GOG: COG0084     Description: Sec-independent secretion Tat            aa           a  a           t  c           c  a           g  a           t  g           a  a           g  a            aa            tg            ag            ta            aa            ag            tt aa        a c  a       a a  c       a a  t       t t  t      | a  a      t c  a      g t  t       t at        t tg        a at        a gt        t ta       | ta       | ta       | at       | ta        t ta        c at        a        ag |  a      |        a  t g  t      a         gc g  a      a         gc tg       c         at ta       a         at at        a        at tg        t        gc                         ttgttttttttatgggggcataaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0084 Mg-dependent DNase ... can be seen here     ..................................................................................................................