                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:165 nt.    Distance to gene:21 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-13.40 kcal/mol
Antiterminator:    Distance from promoter:150 nt. Size=27 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:    Distance from promoter:117 nt.    Size=46 nt.     Delta G=-17.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTAGC-TAGATT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTAGCTGCACGTGCCAAATTTTTAGATTTTATCTATTTTTGTCGTGCGATTTTTCAT
GATGTAGTTGTTAACGGGATACGTATGCCCTTTTTTAACAATTGCATAGTGACTATTG
AACGATAGaaatctcttcacccatttttaatcaacgtgtgaaaagggagctatttggcttcctttttctatgccgaaaaaccatggggaatgtt
tctttctcatggttttttatattgaaaggagtacggaaaATG

    BC0239 Gene: BC0239     GI: 30018476     BI number: BC0239     GOG: COG0488     Description: ABC transporter ATP-binding protein uu tt a  t tg cg gc at gt gc gc                  tt at         a       g  t at       a  a      t  c at       g  a       at at       c  a       at gt       c  c       gt t  c       gc        gc gt        ta        gt ta        at        gc gt        tg        ta cg        cg        at a  c      t  g       cg a  c      t  g       cg cg        ta        at ta        ta        at                         ttttatattgaaaggagtacggaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0488 ATPase components of ABC transporters with duplicated ATPase domains ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC14579                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:130 nt.    Distance to gene:66 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-10.20 kcal/mol Antiterminator:    Distance from promoter:92 nt. Size=47 nt.     Delta G= -6.43 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTTAGC-TAGATT. It has a score value of 65.6 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTTAGCTGCACGTGCCAAATTTTTAGATTTTATCTATTTTTGTCGTGCGATTTTTCAT GATGTAGTTGTTAACGGGATACGTATGCCCTTTTTTAACAATTGCATAGTGACTATTG AACGATAGaaatctcttcacccatttttaatcaacgtgtgaaaagggagctatttggcttcctttttctatgccgaaaaaccatggggaatgtt tctttctcatggttttttatattgaaaggagtacggaaaATG     BC0239 Gene: BC0239     GI: 30018476     BI number: BC0239     GOG: COG0488     Description: ABC transporter ATP-binding protein uu   a t  a t  t t  c t  a t  a a  c c  g c  t cg at cg ta |  a |  a ta cg        tt tg       a  t cg        tg ta        cg a  g       gc a  |       at a  |       gt Gc        gc At        gc Ta        at             ttttctatgccgaaaaaccatggggaatgtttctttctcatggttttttatattgaaaggagtacggaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0488 ATPase components of ABC transporters with duplicated ATPase domains ... can be seen here     ..................................................................................................................