                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:61 nt.    Distance to gene:95 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-15.90 kcal/mol
Antiterminator:    Distance from promoter:32 nt. Size=42 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGTA-TATAGC. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGTATAGCGGTTTACTTTTTATATAGCCGAAAACATAGTGCTTTAAATAATAGTAA
AAAAGAAGAAGATGTTGCAAATTTATAAgcgaaaaaatccattctaattctgttagaatggatttttttatttgaaaat
ttacatttttttgaacttattataagataattgttggctaactaaaggggtgaaatgatgaaaaatacgtggcgtgagttaagggagATG

    BC0256 Gene: BC0256     GI: 30018493     BI number: BC0256     GOG: COG0477     Description: Multidrug resistance protein TT T  A A  T A  A A  A Cg         c Gc       t  t Tg        tg Ta        at |  a       at |  a       ta |  a       cg G  a       ta Ta        ta At        at Gc        cg A  c       cg A  a       ta G  |       at At        at At        at Gc        at At        at             ttatttgaaaatttacatttttttgaacttattataagataattgttggctaactaaaggggtgaaatgatgaaaaatacgtggcgtgagttaagggagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................