                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:52 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-22.00 kcal/mol
Antiterminator: Size=72 nt.     Delta G= -9.45 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-15.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGACGCGGCGGTGGCGATGGACGTAATCGTGACCGTAACCGTGATGGACGTAATCGT
GACGGAAACCGTGATCGCAATCGTGATGGTAACCGCGATCGTAATCGTGATGGTGGTA
GTCGTGGTCGTAGAGGTGAAGGCCAAGGTCGCCCTGGTTCTTCAAATGGACGCGGCGA
AAGAAAACATCATAGCCGTCCACAAGCTTAAtaaaaaaaagagaatgccctttgcgggcattctctttttttatttc
tataattgtgcatactacataatagttatgatagaaaaggggctgttatATG

    BC0260 Gene: BC0260     GI: 30018497     BI number: BC0260     GOG: COG4294     Description: UV-endonuclease (UvsE/Uve1/UvdE Family             A           A  C           A  A            AT            GC           A  A           A  T           A  A           G  |            CG            GC            GC           C  |           G  |            CG            AT            GC            GC            TA CG       |  C T  C      |  A GC       |  A GC       |  G A  |      |  C AT       |  T CG       |  T CG       |  A |  T      |  A GT       |  t        t GC       |  a      t  g AT       |  a      t  c AT       |  a       cg GC       |  a       cg TA       A  a       cg |  A      A  a       gc |  A      A  a       ta G  T      C  a       at G  G       Tg        at A  G       Ta        gc G  A       Cg        at A  C       Ta        gc TG       |  a       at GC       |  t       at CG        Tg        at TG        Gc        at GC        Gc        at                         ttatttctataattgtgcatactacataatagttatgatagaaaaggggctgttatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG4294 UV damage repair endonuclease ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC14579                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-12.30 kcal/mol Antiterminator: Size=72 nt.     Delta G= -9.45 kcal/mol Anti-antiterminator:   Size=34 nt.     Delta G= -8.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGGACGCGGCGGTGGCGATGGACGTAATCGTGACCGTAACCGTGATGGACGTAATCGT GACGGAAACCGTGATCGCAATCGTGATGGTAACCGCGATCGTAATCGTGATGGTGGTA GTCGTGGTCGTAGAGGTGAAGGCCAAGGTCGCCCTGGTTCTTCAAATGGACGCGGCGA AAGAAAACATCATAGCCGTCCACAAGCTTAAtaaaaaaaagagaatgccctttgcgggcattctctttttttatttc tataattgtgcatactacataatagttatgatagaaaaggggctgttatATG     BC0260 Gene: BC0260     GI: 30018497     BI number: BC0260     GOG: COG4294     Description: UV-endonuclease (UvsE/Uve1/UvdE Family             a           a  a           t  a            Aa            Aa           T  a           T  a           C  g           G  |            Aa            Ag            Ca           A  |           C  |            Ca            Tt            Gg            Cc            Cc           |  c           |  t           |  t           |  t           |  g           |           |           |   A       | A  C      | A  A      | AT       | GC       | A  A      | A  T      G A  A      A G  |      T          t CG       A        t  g GC        C       t  c GC        T        cg C  |       A        cg G  |       C        cg CG       |         gc AT       |         ta GC        A        at GC        A        at TA        A        gc                         tctttttttatttctataattgtgcatactacataatagttatgatagaaaaggggctgttatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG4294 UV damage repair endonuclease ... can be seen here     ..................................................................................................................