                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.60 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -3.00 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -6.14 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAGTCCAACGGTGATTGTAGCGGCTATTACTGCACAGATTCAAAAAGCGAAATTACC
CACTCATGTGGAAATTGATGCGAAAAAGTACGGTTTTGAGAGAGATTCTGTTATTTTA
CTTGAGCAGATTCGAACAATCGATAAGCAGCGCTTAACGGACAAAATCACTCACTTAG
ATGAAGTGATGATGATTCGTGTAGATGAAGCGCTACAAATTAGTTTAGGACTAATAGA
TTTTTAAatcggcagtttaagttgctctctttgaagggcaactttttttattatagaggaggttacggTTG

    BC0267 Gene: BC0267     GI: 30018504     BI number: BC0267     GOG: COG2183     Description: Transcription accessory protein (S1 RNA binding domain AA G  G       TT T  C      T  A A  G       TA GC        Ta AT        At TA        Gc GC       A  g TA       T  g G  A      A  c C  A      A  | T  T       Ta        tt T  T       Cg       t  g A  A       At       c  a G  G       Gt        ta T  T       Gt        cg AT       |  a       tg GT       |  a       cg TA       A  g       gc A  G      T  t       ta G  G      T  t       ta TA        Tg        gc GC        Gc        at AT        At        at                         tttttattatagaggaggttacggTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG2183 Transcriptional accessory protein ... can be seen here     ..................................................................................................................