                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:165 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-14.10 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-11.35 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCCGTTCCCATACCGAACACGGAAGTTAAGCTCTCTAGCGCCGATGGTAGTTGGGACC
TTGTCCCTGTGAGAGTAGGACGTCGCCAAGcaagaacctaagtcattttgacttgggtttttttgtgtttatttttat
tatttttaatttaaaggtaagaattaccttttcaagaatatagtccagatgtaaaaagaatgtttgtgatcttacataaccttttgtgcttttaaaggat
tttacattagaaaaaatctataattaaggtagttaacatatatttttgatgggtgtggggaattATG

    BC0318 Gene: BC0318     GI: 30018529     BI number: BC0318     GOG: COG0697     Description: Transporter, Drug/Metabolite Exporter famil   T C  T CG         A AT       A  G GC       C  c GC       C  a GC       G  a T  T       Cg T  G       Ta G  T      G  a        t A  G      C  |      t  t T  A      A  |      a  t G  G       Gc        cg G  A       Gc        ta T  G       At        gc A  T       Ta        at G  A      G  a       at CG       A  g       tg CG       G  |       cg |  A       At        cg GC        Gc        at CG        Ta        at GT        Gt        gt                         ttttgtgtttatttttattatttttaatttaaaggtaagaattaccttttcaagaatatagtccagatgtaaaaagaatgtttgtgatcttacataaccttttgtgcttttaaaggattttacattagaaaaaatctataattaaggtagttaacatatatttttgatgggtgtggggaattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GER] COG0697 Permeases of the drug/metabolite transporter (DMT) superfamily ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC14579                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:178 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-14.10 kcal/mol Antiterminator: Size=38 nt.     Delta G= -5.40 kcal/mol Anti-antiterminator:   Size=52 nt.     Delta G=-13.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CCCGTTCCCATACCGAACACGGAAGTTAAGCTCTCTAGCGCCGATGGTAGTTGGGACC TTGTCCCTGTGAGAGTAGGACGTCGCCAAGcaagaacctaagtcattttgacttgggtttttttgtgtttatttttat tatttttaatttaaaggtaagaattaccttttcaagaatatagtccagatgtaaaaagaatgtttgtgatcttacataaccttttgtgcttttaaaggat tttacattagaaaaaatctataattaaggtagttaacatatatttttgatgggtgtggggaattATG     BC0318 Gene: BC0318     GI: 30018529     BI number: BC0318     GOG: COG0697     Description: Transporter, Drug/Metabolite Exporter famil   A G  T CG CG GT |  A CG GT         G AT       G  A TG       A  C CG       T  G T  |      G  T CG        AC TA        GG C  C      A  C        t GC       G  |      t  t AT       T  |      a  t AT        GC        cg TG        TA        ta T  T       CA        gc G  C       CG        at A  C      C  c       at A  |      T  a       tg GC       G  |       cg GT        Ta        cg CG        Tg        at AT        Ca        at CG        Ca        gt                         ttttgtgtttatttttattatttttaatttaaaggtaagaattaccttttcaagaatatagtccagatgtaaaaagaatgtttgtgatcttacataaccttttgtgcttttaaaggattttacattagaaaaaatctataattaaggtagttaacatatatttttgatgggtgtggggaattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GER] COG0697 Permeases of the drug/metabolite transporter (DMT) superfamily ... can be seen here     ..................................................................................................................