Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:179 nt.    Distance to gene:19 nt.     Distance to run of Ts=2 nt.   Size=29 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgata-caagat. It has a score value of 65.6 and is shown in blue

ttgatatggatgtttaaaaagtccggtcaagataaccttcgcatgtcgtcgttgcatcgccagtgcggtactcatgtaggaaaactacactccgtgttct
cctggcaaatgcgcctagacctgctcggtgctcttgatcctcctttttaaacctttattgatagggatgtttaaaaagtccggtcgagataaccttttat
tgatatgaaaaagcaaactaggagcatagcttctagtttgtacttatttaattattgggggatgaaatATG

    BC0334


Gene: BC0334     GI: 30018542     BI number: BC0334     GOG: COG0151     Description: Phosphoribosylamine--glycine ligas


           t
         a  a
          cg
          gc
          at
          gt
          gc
          at
          ta
          cg
          at
          at
          at
          cg
          gt
            acttatttaattattgggggatgaaatATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[F] COG0151 Phosphoribosylamine-glycine ligase ... can be seen here

    ..................................................................................................................