                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:147 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-18.60 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -4.30 kcal/mol
Anti-antiterminator:   Size=74 nt.     Delta G=-13.04 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGTCAAAAGGAAGTTATGACGCTTCTGACAAAGAGATTGAGTCAGCGATTGAAAATA
TAATCCTGGCAAAACCGCTTTGAatcatttgtcacgatgcaagatgctctcaaagggacttagctgctgcagtgggcggttaa
gtcttctttattttaccataaaacagaacgtacattctctttttcggccttaaaatgtatataaaagatatcaatcaataaaattcagaaaattaggtgc
atacctcttgcttaaaatgatataaaagtgatatcatttttatatcaggaggcgatcatATG

    BC0336 --- BC0335 Gene: BC0336     GI: 30018544     BI number: BC0336     GOG: COG0330     Description: Somatin-like protein Gene: BC0335     GI: 30018543     BI number: BC0335     GOG: COG4877     Description: hypothetical protei TT T  G C  A G  a C  t C  c A  a At At At Cg Gt Gc Ta C  c Cg Ta At A  g T  | A  | T  | A  |        a        ag A  |      a  a      c  t A  |      c  g      g  g A  |       tg        tg Gc        cg        cg Ta        ta        gc Ta       |  c       tg |  g      |  t       cg A  a      |  t       gt Gt       |  a       at Cg        cg        ta Gc        gc        ta At       t  t       cg C  |      a  g       at T  |      g  c       gc Gc       a  |       gt At        at       g  t Gc        cg       a  c Ta        gc        at Ta        ta        at                         tattttaccataaaacagaacgtacattctctttttcggccttaaaatgtatataaaagatatcaatcaataaaattcagaaaattaggtgcatacctcttgcttaaaatgatataaaagtgatatcatttttatatcaggaggcgatcatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0330 Membrane protease subunits, stomatin/prohibitin homologs ... can be seen here [S] COG4877 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................