                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:167 nt.    Distance to gene:46 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-15.00 kcal/mol
Antiterminator:    Distance from promoter:131 nt. Size=48 nt.     Delta G= -3.90 kcal/mol
Anti-antiterminator:    Distance from promoter:107 nt.    Size=44 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATA-GAAAAG. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATATTCCTGTCCAGTTTAATGGAAAAGCTGAAATAGTTGGTTTTACACAATATGT
GGCAGGGCTTGTTATGGAATACTTCCCGAATTATATGAAAGTACAAGTAACGATTAAA
TCTGTAGAACGCCCAGAAGCTATTATTATACGTGAAGCAAAACAAGATGAACCACTTG
TGAAGATTTTAGATTAAatatgaaggctgttcctctatggaacagctttttttcttatgtaattttgttataatttaaaatgttgtaa
aaaataggggtaaggggtaaagctcATG

    BC0343 Gene: BC0343     GI: 30018551     BI number: BC0343     GOG: COG0730     Description: hypothetical Membrane Spanning Protei            GA           A  T           T  T CA        TA A  A       TA A  G       Ta A  A       At AT       G  a CG       A  t G  A      A  g A  A      G  a A  C      T  | GC       G  |        t TA        Ta       c  a GC        Tg       t  t C  T       Cg        cg AT       A  c       cg TG       C  t       ta AT        Cg        ta TG        At        gc TA        At        ta A  A       Gc        cg TG       T  c       gc TA        At        gt AT        Gc        at                         tttttcttatgtaattttgttataatttaaaatgttgtaaaaaataggggtaaggggtaaagctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0730 Predicted permeases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC14579                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:165 nt.    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-17.20 kcal/mol Antiterminator:    Distance from promoter:131 nt. Size=48 nt.     Delta G= -3.90 kcal/mol Anti-antiterminator:    Distance from promoter:97 nt.    Size=44 nt.     Delta G= -4.00 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGATA-GAAAAG. It has a score value of 60.24 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGATATTCCTGTCCAGTTTAATGGAAAAGCTGAAATAGTTGGTTTTACACAATATGT GGCAGGGCTTGTTATGGAATACTTCCCGAATTATATGAAAGTACAAGTAACGATTAAA TCTGTAGAACGCCCAGAAGCTATTATTATACGTGAAGCAAAACAAGATGAACCACTTG TGAAGATTTTAGATTAAatatgaaggctgttcctctatggaacagctttttttcttatgtaattttgttataatttaaaatgttgtaa aaaataggggtaaggggtaaagctcATG     BC0343 Gene: BC0343     GI: 30018551     BI number: BC0343     GOG: COG0730     Description: hypothetical Membrane Spanning Protei            GA           A  T           T  T TG        TA G  A       TA C  A       Ta A  G       At TC       G  a AA       A  t T  A      A  g T  A      G  a        t A  A      T  |      c  a TC       G  |      t  t TA        Ta        cg AA        Tg        cg T  G       Cg        ta CA       A  c       ta GT       C  t       gc AG        Cg        ta AA        At        cg GA        At        gc A  C       Gc        gt CC       T  c       at CA        At        at CC        Gc        gt                         tttcttatgtaattttgttataatttaaaatgttgtaaaaaataggggtaaggggtaaagctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0730 Predicted permeases ... can be seen here     ..................................................................................................................