                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:53 nt.    Distance to gene:115 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-10.60 kcal/mol
Antiterminator:    Distance from promoter:26 nt. Size=41 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGAT-TTTATT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGATATGTAAGGACTTTATTTTTATTAGTTACTATATTATTGATCGGGAAAAATGT
TTTGGAATATACTCATATTTTGTAGattcatacgcatgtatgaatctcttttttttattatattttaaaaatttattaattt
ttaaaatataagtctaggaatatttgaataaatctaaattatcgtgtagaataatgttgtaaaatgtaaacgtttttctaaggggaggctaaaaaaaAT
G

    BC0344 Gene: BC0344     GI: 30018552     BI number: BC0344     GOG: COG1012     Description: Delta-1-pyrroline-5-carboxylate dehydrogenas   A T  T A  T C  T T  T CG AT TA A  G Ta        ca At       g  t At        cg Gc        at G  a       ta T  t       at T  a       cg T  c       ta Tg        ta Gc        at Ta        Gc At        At             cttttttttattatattttaaaaatttattaatttttaaaatataagtctaggaatatttgaataaatctaaattatcgtgtagaataatgttgtaaaatgtaaacgtttttctaaggggaggctaaaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1012 NAD-dependent aldehyde dehydrogenases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC14579                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:53 nt.    Distance to gene:122 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-10.60 kcal/mol Antiterminator:    Distance from promoter:17 nt. Size=41 nt.     Delta G= -5.10 kcal/mol Anti-antiterminator:   Size=50 nt.     Delta G= -3.40 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGGAT-TTTATT. It has a score value of 60.24 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGGATATGTAAGGACTTTATTTTTATTAGTTACTATATTATTGATCGGGAAAAATGT TTTGGAATATACTCATATTTTGTAGattcatacgcatgtatgaatctcttttttttattatattttaaaaatttattaattt ttaaaatataagtctaggaatatttgaataaatctaaattatcgtgtagaataatgttgtaaaatgtaaacgtttttctaaggggaggctaaaaaaaAT G     BC0344 Gene: BC0344     GI: 30018552     BI number: BC0344     GOG: COG1012     Description: Delta-1-pyrroline-5-carboxylate dehydrogenas   A T  T C  A A  T T  T TA         T GT       A  A AT       A  T TG       G  A TA       G  C AT        TT T  C       TC T  G       TA TG       T  T TG        GA        ca TA        TT       g  t A  A       AT        cg TA        AT        at TA       A  T       ta TA       A  G       at |  T      A  T       cg CG       G  A       ta AT        GG        ta GT        Ga        at GT        Ct        Gc AT        Tt        At                         cttttttttattatattttaaaaatttattaatttttaaaatataagtctaggaatatttgaataaatctaaattatcgtgtagaataatgttgtaaaatgtaaacgtttttctaaggggaggctaaaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1012 NAD-dependent aldehyde dehydrogenases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC14579                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:54 nt.    Distance to gene:129 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -9.00 kcal/mol Antiterminator:    Distance from promoter:17 nt. Size=41 nt.     Delta G= -5.10 kcal/mol Anti-antiterminator:   Size=50 nt.     Delta G= -3.40 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGGAT-TTTATT. It has a score value of 60.24 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGGATATGTAAGGACTTTATTTTTATTAGTTACTATATTATTGATCGGGAAAAATGT TTTGGAATATACTCATATTTTGTAGattcatacgcatgtatgaatctcttttttttattatattttaaaaatttattaattt ttaaaatataagtctaggaatatttgaataaatctaaattatcgtgtagaataatgttgtaaaatgtaaacgtttttctaaggggaggctaaaaaaaAT G     BC0344 Gene: BC0344     GI: 30018552     BI number: BC0344     GOG: COG1012     Description: Delta-1-pyrroline-5-carboxylate dehydrogenas   G A  T T  T T  A A  C TT         T TA       A  A TT       A  T TA       G  A TT       G  C AT        TT T  A       TC T  T       TA TT       T  T CG        GA AA        TT        ca G  T       AT       g  t GC        AT        cg AG       A  T       at AG       A  G       ta |  G      A  T       at TA       G  A       cg GA        GG        ta TA        Ga        ta AA        Ct        at TA        Tt        Gc                         tcttttttttattatattttaaaaatttattaatttttaaaatataagtctaggaatatttgaataaatctaaattatcgtgtagaataatgttgtaaaatgtaaacgtttttctaaggggaggctaaaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1012 NAD-dependent aldehyde dehydrogenases ... can be seen here     ..................................................................................................................