                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:119 nt.    Distance to gene:108 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-12.60 kcal/mol
Antiterminator:    Distance from promoter:53 nt. Size=71 nt.     Delta G= -3.75 kcal/mol
Anti-antiterminator:    Distance from promoter:28 nt.    Size=42 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ATGAAA-TACTAT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGAAACGCTTAGTGTAAAAGGATACTATTTAATTGGAACATTATTTTTAACGATGTC
TTGTTTTGTATTACAAAAAACAATTCGTGATAATGAAGAAGATAACGAGAGATTTCCA
AAAAATAAACCGTTAGATAAAGAGTAAattgtaaagaaaggcatttgcctttctttttttatgtaaaaatggcgtaagta
ctctgtgttgacttgcttgaagtactgaaaatttggtatcatcaatagtattgtagattgaacgatatattatggaggtggcctagccGTG

    BC0350 --- BC0351 --- BC0352 Gene: BC0350     GI: 30018558     BI number: BC0350     GOG: COG0721     Description: Glutamyl-tRNA(Gln) amidotransferase subunit C Gene: BC0351     GI: 30018559     BI number: BC0351     GOG: COG0154     Description: Glutamyl-tRNA(Gln) amidotransferase subunit A Gene: BC0352     GI: 30018560     BI number: BC0352     GOG: COG0064     Description: Glutamyl-tRNA(Gln) amidotransferase subunit             A           C  A           C  A            TA            TA            TA            AT           G  A           A  A           G  A           A  C            GC            CG            AT            AT            TA           |  G AC       |  A A  A      |  T A  A      |  A A  T      A  A A  T      G  A A  C      A  G CG       A  A AT       G  G TG       A  T TA       A  A       tt AT       G  A      a  t TA        Ta        cg G  A       At        gc T  T       At        gc TG        Tg        at TA        At        at TA       G  a       at G  G      T  a       gc TA       G  a       at TA        Cg        at CG        Ta        at                         ttttatgtaaaaatggcgtaagtactctgtgttgacttgcttgaagtactgaaaatttggtatcatcaatagtattgtagattgaacgatatattatggaggtggcctagccGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0721 Asp-tRNAAsn/Glu-tRNAGln amidotransferase C subunit ... can be seen here [J] COG0154 Asp-tRNAAsn/Glu-tRNAGln amidotransferase A subunit and related amidases ... can be seen here [J] COG0064 Asp-tRNAAsn/Glu-tRNAGln amidotransferase B subunit (PET112 homolog) ... can be seen here     ..................................................................................................................