                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:72 nt.    Distance to gene:32 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -8.70 kcal/mol
Antiterminator:    Distance from promoter:11 nt. Size=67 nt.     Delta G=-11.43 kcal/mol
Anti-antiterminator:    Distance from promoter:3 nt.    Size=26 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-tggact. It has a score value of 74.3 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaatgaatatttacttttgatggactacacgaatcgggttcttactgcctgtttgagcgggataaaagaaggatagcaagatgagaggaggtaggca
tgggaatactgaatagaagttcagtatgttctttttcgatacataaagaaatttcctgtgctaataaATG

    BC0353 Gene: BC0353     GI: 30018561     BI number: BC0353     GOG: COG1597     Description: hypothetical protei             a           a  g           a  a           a  a           t  g           a  g           g  a           g  t           g  a            cg            gc           |  a           |  a           |  g           |  a           |  t           a  g           g  a            tg            ta            tg           g  g            ta            cg        ga   t        cg       a  a t  a       gt        tg c  c       ta        at t  t       cg        at tg       |  g       gc gc       |  c       ta gc       |  a       cg gt        at        at cg        tg        ta t  |       tg        at at        cg       a  g at        ta        gt gt        ta        gt cg        gt        gc                         tttttcgatacataaagaaatttcctgtgctaataaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IR] COG1597 Sphingosine kinase and enzymes related to eukaryotic diacylglycerol kinase ... can be seen here     ..................................................................................................................