                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:128 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-10.70 kcal/mol
Antiterminator: Size=68 nt.     Delta G=-10.60 kcal/mol
Anti-antiterminator:   Size=63 nt.     Delta G=-11.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTGTTATATACACAAGCGAACCGAATTAAAGTACATTCACCAGATAAACTAATGATT
AATTTAGATGGTGAGTATGGTGGAGATGCACCGATGGAATTCGAAAATATATATCATT
GTTTAGAACTATTTGTTCCTGAACATCAAGAGGATGCCCTGTAAaggcatcctcttttactttgtta
aaatgaattgtaaattgggagttagtttgatttttatggtatttttacaattcttttattttacatccatattttattgatacactggaggagataagaa
acgagaggtaggatgctATG

    BC0354 Gene: BC0354     GI: 30018562     BI number: BC0354     GOG: COG0546     Description: Phosphoglycolate phosphatas             T           A  T           T  T            CG            AT GA        AT A  T      |  C G  G       GC GC        AT TA        TG GC        TA GC        TA TG        GC |  A       TA |  T      T  | |  G      A  | |  G      C  | |  A      T  | |  A      A  | |  T      T  | |  T      A  | |  C      T  | |  G      A  | |  A      T  | |  A      A  | |  A      A  | |  A      A  | |  T      A  | |  A      G  | |  T      C  | A  A      T  | T  T      T  | G  A      A  | AT        AT GC        GC         T TA       G  A      G  A GT       T  A      T  A G  T      A  G      C  a T  G      G  A       Cg AT        CG        Cg GT        CG        Gc AT       |  A       Ta TA        AT        At TG        CG        Gc TA        GC        Gc                         tcttttactttgttaaaatgaattgtaaattgggagttagtttgatttttatggtatttttacaattcttttattttacatccatattttattgatacactggaggagataagaaacgagaggtaggatgctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0546 Predicted phosphatases ... can be seen here     ..................................................................................................................