                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-22.30 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -8.30 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G= -8.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGAAATTTAATTTAGAATCATGTGAGGTTGCGGTTGTTGGAGATACGCCAACTGATTT
ACATTTAGCTAAAAATGGCGATTGCTATGCAATTGGGGTGCTATCTGGTACAGGAGAC
CGTCCAACATTAGAACCACTTGCTGATTTAGTGTTAGATTCTGTTGGAGAGTTTATTT
CTCAATCGGGTGAGTTTTTCTGGGAGAAAGAAGAGTCTAATGTGTAAggaaaataagtctataaa
gactcttaatgagtctttatagacttattttttatgcctggatacaaagaatataggataaATG

    BC0355 Gene: BC0355     GI: 30018563     BI number: BC0355     GOG: COG0160     Description: 4-aminobutyrate aminotransferas   A G  G G  A G  A TA CG TA        at TA       a  a TG       a  a TA       a  g TG        gt         a |  T       gc       t  a GC       A  |      t  t AT        At        cg G  A       Ta        ta TA        Gt        cg GT        Ta        at G  G      G  a       gc GT       T  |       at CG       A  |       at T  T      A  |       at A  A       Ta        ta A  A       Cg        at C  |       Ta        ta Tg        Gc        cg Cg        At        ta Ta        Gc        gc Ta        At        at Ta        At        at                         attttttatgcctggatacaaagaatataggataaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0160 4-aminobutyrate aminotransferase and related aminotransferases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC14579                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:104 nt.     Distance to run of Ts=3 nt.   Size=29 nt.     Delta G= -7.30 kcal/mol Antiterminator: Size=21 nt.     Delta G= -4.30 kcal/mol Anti-antiterminator:   Size=54 nt.     Delta G=-10.60 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AGAAATTTAATTTAGAATCATGTGAGGTTGCGGTTGTTGGAGATACGCCAACTGATTT ACATTTAGCTAAAAATGGCGATTGCTATGCAATTGGGGTGCTATCTGGTACAGGAGAC CGTCCAACATTAGAACCACTTGCTGATTTAGTGTTAGATTCTGTTGGAGAGTTTATTT CTCAATCGGGTGAGTTTTTCTGGGAGAAAGAAGAGTCTAATGTGTAAggaaaataagtctataaa gactcttaatgagtctttatagacttattttttatgcctggatacaaagaatataggataaATG     BC0355 Gene: BC0355     GI: 30018563     BI number: BC0355     GOG: COG0160     Description: 4-aminobutyrate aminotransferas   T T  G C  C AT CG C  A A  | AT GT AT TA TG AT CG AT                   T AT                 T  A C  A                T  T CG                  GT TA         T        AT GT       T  G       GC C  |      G  G       AT C  |       TA        GC AT        CG       G  A GC        TA       T  A AT        TG       T  T G  G       AT        GC GT        GT        TG AT        AT        CG CG        TA        TG                         TGAGTTTTTCTGGGAGAAAGAAGAGTCTAATGTGTAAggaaaataagtctataaagactcttaatgagtctttatagacttattttttatgcctggatacaaagaatataggataaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0160 4-aminobutyrate aminotransferase and related aminotransferases ... can be seen here     ..................................................................................................................