Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:40 nt.    Distance to gene:102 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-12.10 kcal/mol
Antiterminator:    Distance from promoter:20 nt. Size=25 nt.     Delta G= -4.20 kcal/mol
Anti-antiterminator:   Size=75 nt.     Delta G= -6.35 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTCAA-TATTGT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTCAAGCATTTTGTATTCTTTTTATTGTTTTGGGTGTCATTGGGCTTAAGGTTTCAT
CGGCATCATGAaagctatcttttgtagaagatagcttttttctatttgtgcagttaacaattaatacgacaaaatatgacaagaaagagtaa
agcgttttgttatgatacatatgaaatattgtcttatgtggaggaaagagtATG

    BC0359


Gene: BC0359     GI: 30018567     BI number: BC0359     GOG: -------     Description: IG hypothetical 1796


  T
A  T
T  G
T  T
T  T
T  T
T  T
 CG
 TG
 TG
 AT
 TG
|  T
 GC
 TA
T  T
T  T
T  G
A  G
 CG
 GC
 AT
 AT
C  A
 TA
 TG
 TG
 AT         C        gt
T  T      G  A      t  a
T  T      G  T       tg
T  C      C  C       ta
G  A       TA        ta
A  T       AT        cg
T  C       CG        ta
T  G       TA        at
A  |       Ta        ta
T  |       Ta        cg
A  |      G  g       gc
 CG        Gc        at
 GC        At        at
                        ttttctatttgtgcagttaacaattaatacgacaaaatatgacaagaaagagtaaagcgttttgttatgatacatatgaaatattgtcttatgtggaggaaagagtATG


    ..................................................................................................................