                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:151 nt.    Distance to gene:43 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -6.30 kcal/mol
Antiterminator:    Distance from promoter:115 nt. Size=41 nt.     Delta G= -3.50 kcal/mol
Anti-antiterminator:    Distance from promoter:57 nt.    Size=69 nt.     Delta G= -3.73 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaca-taaaat. It has a score value of 70.95 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttacaaagaattgtgcgataaataaaataaaatgaatcgaaatctttttgaacaatttttgtcatctcgaatatataattaggaagtatattacgatga
tagttagaaatattgactcaaagtgctaacgagatataataaaacctagatatacctttcaaaaagaagaatacatatttataggatgaaaaaattcaac
ctattattttttatagcttttagaaaacgcttacaattggtgtggaggggaaaccATG

    BC0378 --- BC0379 Gene: BC0378     GI: 30018586     BI number: BC0378     GOG: COG4857     Description: 5-methylthioribose kinase Gene: BC0379     GI: 30018587     BI number: BC0379     GOG: COG0182     Description: Methylthioribose salvage protei ct a  c g  a ta ta a  g t  t a  g a  | a  | gc at ta ta gc |  g |  a |  g |  a       aa |  t      a  g |  a      a  a |  t      a  a |  a       cg |  a       ta a  t       ta t  a      t  t a  a      c  a g  a      c  c t  a      a  |       aa a  c       ta       a  a g  c       at        at c  t       ta        at a  a       at        gc tg        gt        ta ta       |  t      a  a at       |  a       gc ta        at        gc at        ta        at ta        cg        ta gc        cg        at                         tattttttatagcttttagaaaacgcttacaattggtgtggaggggaaaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4857 Predicted kinase ... can be seen here [J] COG0182 Predicted translation initiation factor 2B subunit, eIF-2B alpha/beta/delta family ... can be seen here     ..................................................................................................................