                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=3 nt.   Size=31 nt.     Delta G=-10.00 kcal/mol
Antiterminator: Size=24 nt.     Delta G= -3.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATTAGTGGAAGAAATATTGAACGAACCAATTCCAGAAGATATGGATGTTAAAGACGA
AGATTAAactatgggaaatcccttatgaagatatgcagaaatgtatcttcataagggattttttgtttgaagatatcaaaaacataaggagttct
tagcctttcttcaaattttgataggtagtagtctaccatgttaaaagcatatttttttctagctaggacaaacatagagaacgtaacctgtacagataca
tatactatcagtgcaaaagcttataaattaatggaaggggttttctcGTG

    BC0389 --- BC0390 Gene: BC0389     GI: 30018597     BI number: BC0389     GOG: -------     Description: Spore coat protein B Gene: BC0390     GI: 30018598     BI number: BC0390     GOG: -------     Description: Spore coat protein            ag           t  t            gc            at aa        ta a  t       gc c  t       gc t  t      |  a t  t       at cg        tg ta        at t  t       gt ta        ta cg        ta cg        ta gt        ta             gcatatttttttctagctaggacaaacatagagaacgtaacctgtacagatacatatactatcagtgcaaaagcttataaattaatggaaggggttttctcGTG     ..................................................................................................................