                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:109 nt.    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -9.80 kcal/mol
Antiterminator:    Distance from promoter:75 nt. Size=45 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:    Distance from promoter:55 nt.    Size=40 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgttg-taaaat. It has a score value of 75.64 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgttgtgtaaatataaacattttataaaatgtttcaagaagggttttttttataaaatacttcgtttataatggaggaaaatatcgacatgagattgat
tgctcatgtagcggttcagtagtgttatgaaaagataagaaggggtgcacacgcatccttttttctatgcagatattatgaaagaggtggtATG

    BC0394 Gene: BC0394     GI: 30018602     BI number: BC0394     GOG: -------     Description: hypothetical protei             a           g  a   t       t  a a  g      a  a c  t       tg ta        ta cg        gt gc        ta tg       g  a tg       a  g |  t      t  a at       g  a gc       a  | ta        cg tg        tg        ca at        tg       a  c g  a      g  g       cg a  |       gt        gc g  |       cg        ta tg        gc        gt at       a  |       gc cg        ta        gc at        gc        gt gt        ta        at                         ttttctatgcagatattatgaaagaggtggtATG     ..................................................................................................................