                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:165 nt.    Distance to gene:26 nt.     Distance to run of Ts=3 nt.   Size=36 nt.     Delta G=-19.30 kcal/mol
Antiterminator:    Distance from promoter:136 nt. Size=47 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:    Distance from promoter:108 nt.    Size=45 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcac-tacaat. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgcacgcaaaaaggaaatgaattacaatttaactatcggaaaattccgattttaaaaactgaatacttctttatcaagagaggcagagggaccggccct
ttgaagcccagcaacctcagtttatacaaactgaataggtgctaattcctgcaaaatgcaatgcattttggaagataaaactcaactagcatgtaaagct
catctttcttgatactgaaggatgagctttttattatttgaaaaacatatattggaggtatgtaaaATG

    BC0395 Gene: BC0395     GI: 30018603     BI number: BC0395     GOG: COG1878     Description: Metal-dependent hydrolas   a a  t       gc cg       a  a gc       t  t ta        cg at        at at       a  a at       c  a       at at        ta       g  a c  |       cg       t  c g  |      a  c      t  t t  |      a  t       cg cg       a  c       ta cg       a  |       ta ta        ta        tg ta        at        cg |  g       gc        ta a  a       at        at a  t       at        cg t  a       gt        ta c  a       gc        cg g  a      t  t       gc ta       t  t       at gc        tg        at gt        ta        at                         ttattatttgaaaaacatatattggaggtatgtaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1878 Predicted metal-dependent hydrolase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC14579 This operon is putativelly rgulated by Methionine_S-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:169 nt.    Distance to gene:36 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-12.50 kcal/mol Antiterminator:    Distance from promoter:133 nt. Size=47 nt.     Delta G= -5.00 kcal/mol Anti-antiterminator:    Distance from promoter:108 nt.    Size=45 nt.     Delta G= -8.00 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgcac-tacaat. It has a score value of 68.27 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgcacgcaaaaaggaaatgaattacaatttaactatcggaaaattccgattttaaaaactgaatacttctttatcaagagaggcagagggaccggccct ttgaagcccagcaacctcagtttatacaaactgaataggtgctaattcctgcaaaatgcaatgcattttggaagataaaactcaactagcatgtaaagct catctttcttgatactgaaggatgagctttttattatttgaaaaacatatattggaggtatgtaaaATG     BC0395 Gene: BC0395     GI: 30018603     BI number: BC0395     GOG: COG1878     Description: Metal-dependent hydrolas   a a  t       ct cg       a  a gc       a  g ta        cc at        ta at       c  t at       a  g at        at c  |       aa g  |      a  a t  |      t  a       at cg       a  g      g  a cg       g  |      t  c ta        ac       t  t ta        at        cg |  g       gc        ta a  a       ga        ta a  t       tt        tg t  a       tc        cg c  a       tt        ta g  a      t  t       at ta       a  t       cg gc        cc        ta gt        gt        cg                         ctttttattatttgaaaaacatatattggaggtatgtaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1878 Predicted metal-dependent hydrolase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................