                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-11.60 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -3.70 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -5.92 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTTCCATTCAATATAAAGCAAAAATGAATGAGGCGATGTCTTTCTTAGCGAAAGCAA
AATCGATTCGTGATAAATTAGAACGAATTTATATTGCTGCTATGGATTTTTCAATAGT
AGATGCATATAAAGAGGAGATTCAAAAAGAGTTTGAACGAATTGCTGCTACTGTAATT
GAAAAGCAACAATAGacgtttcattaggctgtcagtaatttctgacagtttttttagtatgtagtaaaattaatagtgtattgtcgaat
ttccaaggaaataatcaaaaaatggagatgttatgaaATG

    BC0397 Gene: BC0397     GI: 30018605     BI number: BC0397     GOG: COG3541     Description: hypothetical Cytosolic Protei   A A  T T  T       gt G  G      c  t T  A       at C  A       Gc A  A      A  | TA        Ta CG        At GC        At TA       C  a C  A      A  g       at GC       A  |      a  t TA        Cg       t  t TA        Gc        gc AT        At        at |  A      A  g       cg |  G      A  |       ta A  a       At        gc Gc        Gc        ta Cg        Ta        cg At        Tg        gt At        At        gt                         tttttagtatgtagtaaaattaatagtgtattgtcgaatttccaaggaaataatcaaaaaatggagatgttatgaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3541 Predicted nucleotidyltransferase ... can be seen here     ..................................................................................................................