                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=69 nt.     Delta G=-12.72 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTACATATCGTCGATACAACTTGTACACATCTCGGCTGTGAAGTTGAATGGAATAAT
GGTGATTGTACTTGGGATTGCCCTTGCCATGGTTCTCGTTTTTCAATTGAGGGAGACG
TTCTTGAAGGCCCAGCAGATCAACCGTTAAAACGAGTTGATAATGAGTAAacaaataaagaag
ttcaacaaaattactgttgaacttctttatttgttataaacccttttcagataaaattcgacacaaggaggaaaatattaacattaaataaaataatata
ttcatctacaaattaaaagggGTG

    BC0398 Gene: BC0398     GI: 30018606     BI number: BC0398     GOG: COG0477     Description: Benzoate transport protei            aa           t  a            ag            aa            aa           |  g            ct            at            Ac            Aa            Ta            Gc AA       A  a T  A      G  a TA       T  | GC       A  | CG        Aa |  A       Ta CG       A  t AT        G AT        T CG       | TA       | AT       | G  A      | A  A      | C  |      T G  |      G          t AT       A        a  t CG       G        a  a C  A       C       a  c CG        A        at GT        A        cg G  A       A        at A  A       A        at A  a      T  |       cg Gc        T        ta Ta        G        ta Ta        C        gc                         ttctttatttgttataaacccttttcagataaaattcgacacaaggaggaaaatattaacattaaataaaataatatattcatctacaaattaaaagggGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................