                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:153 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G=-13.70 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -3.24 kcal/mol
Anti-antiterminator:   Size=61 nt.     Delta G= -9.05 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTTTAGAAAAAGTATATGAAGCACTAGAAGAAAAAGCCGGTACTATTATTTCAAAAC
AGAATGTATGCATGTATGTTTAAattattatgtacgctacttagtagtaaaaaaagaatgaggttaataacttcattcttttt
atttattaatattttttgtactcattgttcataaagttttcatgatgaaatctgaatatacaagttaattatgataaaattcaaattgaatacgctttct
tgatttttcgctccaacatacagcaagagagagggaattttatgaatagacggaacgtaGTG

    BC0410 Gene: BC0410     GI: 30018618     BI number: BC0410     GOG: COG0664     Description: Transcription regulator, Crp famil AT T  G GC TA AT |  G A  T        t G  A      t  a AT        cg CG        at AT        ta AT        cg AT        gt A  A      |  a C  A      |  a T  a      c  a        a T  t      a  a      a  t T  t      t  a       ta A  a      g  a       ta T  t      t  a       gc T  t      a  g       gt A  a       ta        at T  t       ta        gc Cg        at        ta At        tg        at Ta        ta        at Gc       |  g       gc G  |      a  g       at C  |       At        at Cg        At        at Gc        Ta        at At        Ta        at                         atttattaatattttttgtactcattgttcataaagttttcatgatgaaatctgaatatacaagttaattatgataaaattcaaattgaatacgctttcttgatttttcgctccaacatacagcaagagagagggaattttatgaatagacggaacgtaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0664 cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases ... can be seen here     ..................................................................................................................