Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=70 nt.     Delta G= -9.80 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTGAAATATCCAAAATATCTGGAACATCTCGAGAGACAGTTAGCAGCGTATTAAAAC
AATTAAAAAATGATAGCATTGTTACAATTTTAGATAAAAAAATTACAATACATGATCC
AACATATTTTGAAGAAATCTCTATGTGAaaattgtatattgattttttaattcatagtgtatattaataaggttcttta
tatatttataaggaacttttttacgttatcctctataaaaagattgtatagtatggtaataatagctaaaatcgataataaaatacaaagtgaaggggag
aaagaATG

    BC0411


Gene: BC0411     GI: 30018619     BI number: BC0411     GOG: -------     Description: hypothetical protei


           tt
          t  t
           at
           gt
           ta
           ta
           at
          t  t
          a  c
           ta
  A        gt
G  A       ta
A  A       tg
 AT        at
 GC       a  g
T  T      a  |
T  C      A  |
T  T       Gt
 TA        Ta
 AT        Gt
 TG        Ta
 AT        At
 CG       |  t
A  A      |  a
A  a      |  a
C  a      T  t       at
C  |      C  a      t  t
 Ta        Ta        at
 At        Cg        ta
 Gt        Tg        at
 Tg       A  |       ta
 At        At        ta
C  a       At        tg
 At        Gc        cg
 Ta        At        ta
 At        At        ta
 At        Gt        gc
 Cg        Ta        gt
                        tttttacgttatcctctataaaaagattgtatagtatggtaataatagctaaaatcgataataaaatacaaagtgaaggggagaaagaATG


    ..................................................................................................................