                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:173 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-10.90 kcal/mol
Antiterminator: Size=78 nt.     Delta G=-10.07 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G= -5.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTTGCTTTTAAATAACTATGAAGTTGCGGAACATGAAGAAGTAACAACAATTGCTTT
AAAGCCTTATGAAACAAGGGTTTATCGCATTTCATAAtaaaaaaggatgctctttgagcatctttttttatga
aaaaaaataaatttctattgcaaagtgaaaacgcttttattaaaatagatttatgaaaacggttgcgtaaagataaaaataaagtaacataaggaatcgt
tttcataaagggaacagaaattataatttaaatcattatgtttttataaataaaggggaggaagaacagATG

    BC0414 --- BC0415 Gene: BC0414     GI: 30018622     BI number: BC0414     GOG: COG1263,COG1264     Description: PTS system, glucose-specific IIBC component Gene: BC0415     GI: 30018623     BI number: BC0415     GOG: COG3568     Description: Exodeoxyribonuclease II             A           G  A           T  A           A  C            TA            TA            CG            CG           G  G            AT            AT            AT            TA           T  T           T  C            CG            GC            TA           |  T           |  T           |  T           |  C           |  A           |  T AC       |  A A  A      |  A C  A      |  t AT       |  a AT       T  a TG       A  a GC       A  a AT       C  a AT       A  a GT       A  g        t |  A      C  g      t  t |  A      A  a       cg A  A       At        ta A  G       Tg        cg GC        Gc        gc GC       A  |       ta T  T       At        at A  T       Gc        gc g  A       At        gt aT        At        at cG        Gt        at                         ttttatgaaaaaaaataaatttctattgcaaagtgaaaacgcttttattaaaatagatttatgaaaacggttgcgtaaagataaaaataaagtaacataaggaatcgttttcataaagggaacagaaattataatttaaatcattatgtttttataaataaaggggaggaagaacagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1263 Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific ... can be seen here [G] COG1264 Phosphotransferase system IIB components ... can be seen here [R] COG3568 Metal-dependent hydrolase ... can be seen here     ..................................................................................................................