                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:96 nt.     Distance to run of Ts=3 nt.   Size=30 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGCTGGCATTATCCAACAGGTTCAAATGGTCAATGACGGACTAGTAGCCATACTCTC
AGTTTGTATCCACAAACTCCCATGTGTTTCTTATTCATCTACTTCAAAGTCTACTCTT
ATTCTAGTAAAATAAcaagttctttacttttctatttgatatagaggcaactgataaagtgaaactttaatcagttgggattttgttaa
ctccattaaaaacagctgaaatatggagcgaaactgaatctcaagaagatgtatgctatatttaacttatggaaatttgaaaggatgtttttaatATG

    BC0417 Gene: BC0417     GI: 30018625     BI number: BC0417     GOG: COG0550     Description: DNA topoisomerase   g t  a t  t ta at ta cg ta |  g |  g |  c        a |  a      g  a |  a      t  a |  c       gc |  t       at |  g       at |  a       at |  t      |  a ta        ta ta        at ta        gc cg        ta at        cg tg        at ta        at ta        cg             ggattttgttaactccattaaaaacagctgaaatatggagcgaaactgaatctcaagaagatgtatgctatatttaacttatggaaatttgaaaggatgtttttaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0550 Topoisomerase IA ... can be seen here     ..................................................................................................................