                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:130 nt.    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-18.30 kcal/mol
Antiterminator:    Distance from promoter:101 nt. Size=42 nt.     Delta G= -8.60 kcal/mol
Anti-antiterminator:    Distance from promoter:76 nt.    Size=39 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgTTA-TAGACT. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgTTATTTTACTAGAATAAGAGTAGACTTTGAAGTAGATGAATAAGAAACACATGGGA
GTTTGTGGATACAAACTGAGAGTATGGCTACTAGTCCGTCATTGACCATTTGAACCTG
TTGGATAATGCCAGCGTAGGGAGAGTGTAAAAGCACATATTCAGGCACTTTGCGTACG
CGCAAagtgtctttttgtgtatctcccatcattatagttaggagatgaaaaggATG

    BC0419 --- BC0420 Gene: BC0419     GI: 30018627     BI number: BC0419     GOG: COG2145     Description: Hydroxyethylthiazole kinase Gene: BC0420     GI: 30018628     BI number: BC0420     GOG: COG0352     Description: Thiamin-phosphate pyrophosphorylas            AG           A  C AA       A  A T  T      A  C A  G       TA GC        GT GC        TA TA        GT TG        AT GC        GC        AC |  G      |  A      T  G |  T      |  G       GC TA       |  G       CG CG       |  C       GC CG       A  A       TA A  G       GC        TA A  A       GT        Ta G  |       GT        Cg TG        AT        At TA        TG        Cg TG        GC        Gt AT        CG        Gc CG        GT        At                         ttttgtgtatctcccatcattatagttaggagatgaaaaggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG2145 Hydroxyethylthiazole kinase, sugar kinase family ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here     ..................................................................................................................