                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:142 nt.    Distance to gene:87 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-10.20 kcal/mol
Antiterminator:    Distance from promoter:135 nt. Size=12 nt.     Delta G= -3.50 kcal/mol
Anti-antiterminator:    Distance from promoter:108 nt.    Size=31 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttata-gagaat. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttatatgttgtaatctttgaaagagaataaattaattctcatagaactcccatatcgttcaactcgttcagcgagaaaggcaaactgatggaaacatga
ggacgcaaaactacaggagctaaggtcgaaaggctacgctagccagttaccggacggatagggttggtcttggccaatgcttttacattggctttttttt
attctcgaacatattgagaaacattttcaaacaaaatatccatatattttgtttttttgtttgtgttgattaaggaaggtggatattaATG

    BC0422 Gene: BC0422     GI: 30018630     BI number: BC0422     GOG: COG0840     Description: Methyl-accepting chemotaxis protei ga g  c cg cg a  a t  t                 tt t  a                t  t g  g                c  a a  |                 gc cg                  ta cg        tt        at gt       c  g       at at        tg        cg tg        gc        cg cg        gc        gc gt        ta        gt                         tttttttattctcgaacatattgagaaacattttcaaacaaaatatccatatattttgtttttttgtttgtgttgattaaggaaggtggatattaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here     ..................................................................................................................