                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:140 nt.    Distance to gene:28 nt.     Distance to run of Ts=3 nt.   Size=29 nt.     Delta G=-18.70 kcal/mol
Antiterminator:    Distance from promoter:83 nt. Size=72 nt.     Delta G=-22.40 kcal/mol
Anti-antiterminator:    Distance from promoter:50 nt.    Size=59 nt.     Delta G=-13.12 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgttc-tacaat. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgttcaataaaataaatcatgctacaatgaaaacgaattaaggaccggggagccaattggctgagaggatgtaagtaaacatcgaccctcaacctgatc
tggataatgccagcgtagggagttacttaaagtgatgtagcatatgttattctgtaataacttgcatacaaggctttcctacgcagtaggaaagcctttt
cttatttttgaaatttatttttataagggggattttattATG

    BC0424 --- BC0425 --- BC0426 --- BC0427 Gene: BC0424     GI: 30018632     BI number: BC0424     GOG: COG0011     Description: IG hypothetical 16092 Gene: BC0425     GI: 30018633     BI number: BC0425     GOG: COG0600     Description: Hydroxymethylpyrimidine transport system permease protein Gene: BC0426     GI: 30018634     BI number: BC0426     GOG: COG0715     Description: Hydroxymethylpyrimidine-binding protein Gene: BC0427     GI: 30018635     BI number: BC0427     GOG: COG1116     Description: Hydroxymethylpyrimidine transport ATP-binding protei            tg           c  t            ta            ta            at            ta            ta            gc aa       t  t t  t      a  | a  g      t  | gc        at gc        cg ta        gc cg       |  a t  c       at a  g       ta gt        gc ta        ta cg       a  a cg       g  g a  |       tg a  |       gc cg        at ta       a  | cg       a  | |  t      t  | |  t      t  |        c |  a      c  |      g  a |  c      a  |       cg |  t      t  |       at |  t      t  |       ta |  a      g  |       cg c  a       at        cg c  a       gt        ta a  g       gc        ta gt        gc        ta cg        at        cg ta        ta        gc at        gc        gc cg        cg        at at        gc        at                         ttcttatttttgaaatttatttttataagggggattttattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0011 Uncharacterized conserved protein ... can be seen here [P] COG0600 ABC-type nitrate/sulfonate/bicarbonate transport system, permease component ... can be seen here [P] COG0715 ABC-type nitrate/sulfonate/bicarbonate transport systems, periplasmic components ... can be seen here [P] COG1116 ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC14579 This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:141 nt.    Distance to gene:38 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-17.80 kcal/mol Antiterminator:    Distance from promoter:107 nt. Size=72 nt.     Delta G=-22.40 kcal/mol Anti-antiterminator:    Distance from promoter:99 nt.    Size=49 nt.     Delta G=-12.00 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgttc-tacaat. It has a score value of 63.59 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgttcaataaaataaatcatgctacaatgaaaacgaattaaggaccggggagccaattggctgagaggatgtaagtaaacatcgaccctcaacctgatc tggataatgccagcgtagggagttacttaaagtgatgtagcatatgttattctgtaataacttgcatacaaggctttcctacgcagtaggaaagcctttt cttatttttgaaatttatttttataagggggattttattATG     BC0424 --- BC0425 --- BC0426 --- BC0427 Gene: BC0424     GI: 30018632     BI number: BC0424     GOG: COG0011     Description: IG hypothetical 16092 Gene: BC0425     GI: 30018633     BI number: BC0425     GOG: COG0600     Description: Hydroxymethylpyrimidine transport system permease protein Gene: BC0426     GI: 30018634     BI number: BC0426     GOG: COG0715     Description: Hydroxymethylpyrimidine-binding protein Gene: BC0427     GI: 30018635     BI number: BC0427     GOG: COG1116     Description: Hydroxymethylpyrimidine transport ATP-binding protei            tc           t  c            tt            ca            gc            gg            ac            aa           c  g           a  |           t  |            a            c            g           |            t tg        t c  t       c ta        a ta       a   at       t   ta        a ta        a gc        t t  t      g  | a  |      t  | t  |      c  | at       t  | cg       t  |        c gc       a  |      g  a |  a      t  |       cg at       t  |       at ta       g  |       ta gc        t        cg ta        a        cg a  a       t        ta g  g       a        ta tg        c        ta gc        g        cg at        a        gc at        t        gc at        g        at                         tttcttatttttgaaatttatttttataagggggattttattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0011 Uncharacterized conserved protein ... can be seen here [P] COG0600 ABC-type nitrate/sulfonate/bicarbonate transport system, permease component ... can be seen here [P] COG0715 ABC-type nitrate/sulfonate/bicarbonate transport systems, periplasmic components ... can be seen here [P] COG1116 ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................