Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:83 nt.    Distance to gene:15 nt.     Distance to run of Ts=3 nt.   Size=24 nt.     Delta G= -6.10 kcal/mol
Antiterminator:    Distance from promoter:35 nt. Size=60 nt.     Delta G=-19.90 kcal/mol
Anti-antiterminator:    Distance from promoter:34 nt.    Size=27 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaca-tacgat. It has a score value of 76.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttacactaaatcttacatttgttacgatttaatcacccccagctcccttgtatagacttcgtgatgtctgatcattttatctagacgtttcatacgtct
agattcattttggtttattggcgtatgcctttaaatatatcttttattttgaaaggagaaatggctATG

    BC0429


Gene: BC0429     GI: 30018637     BI number: BC0429     GOG: COG3325     Description: Endochitinas


            c
          t  a
          t  t
           ta
           gc
           cg
           at
           gc
           at
           ta
           cg
           ta
           at
          |  t
          |  c
          t  a
          t  t
          t  t
          t  t
 tt        at
a  t       cg
c  t       tg        ta
 ta        at       g  t
 at        gt        cg
 gc       |  t       gc
|  t      |  a       gc
 ta       |  t      t  t
 cg       t  t      t  t
 ta        cg        at
 gc        tg        ta
 tg        gc        ta
 at        tg        ta
 gt        at        gt
                        atatcttttattttgaaaggagaaatggctATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[G] COG3325 Chitinase ... can be seen here

    ..................................................................................................................