                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:148 nt.    Distance to gene:43 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.50 kcal/mol
Antiterminator:    Distance from promoter:99 nt. Size=56 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:    Distance from promoter:79 nt.    Size=50 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGA-TACAGT. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGAAATTAATTGAAGCAGGTATACAGTCTGGAGAGTTCCGTGAAGATAATACTCG
TGATCTTATGTATATTGTGAATGGATTATTATCAGGGCTTGGAGTACTTTACTACGAG
CTAGATTATAAAGAGTTGAAGCGTATTTATAAAAAGGCAATAGATGTATTGTTAAAAG
GAATGGCAGCTGAATAAtaggtcagttgcttttcttacaaaataaattagactgaacggtcggtttgtgaaaggggaATG

    BC0434 Gene: BC0434     GI: 30018642     BI number: BC0434     GOG: COG0477     Description: Macrolide-efflux protei            AT           G  G            AT            TA            AT GA        AT T  A       CG TG        GT GC        GT |  G      A  A A  T      A  A G  A      A  A AT       A  A AT       A  G AT       T  | TA       A  | AT        TG TA        TA TA        TA        At A  A       AT       A  a G  A       TG       T  g A  A      G  G      A  g TG       C  |       At CG       G  |       Gc GC       A  |       Ta A  A      A  |       Cg G  A       GC        Gt C  |       TA        At AT        TG        Cg TA        GC        Gc CG        AT        Gt                         tttcttacaaaataaattagactgaacggtcggtttgtgaaaggggaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................