                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-19.60 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -9.31 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-15.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaacgcc is shown in italic-bold style

tgttttaaaaaagaatttgtattatgataatcaacaaatttatttcgttataacgatgaaaaaggactagtacatgttcaacctttttagcagagagaga
atccgtcaggctgaaagattcttaaaaaggcaatatggaacctgcctttgagttctgcatatgcagcgggaatttcccgttatcaaaaagagagcatgcg
caatttttgtgcatgaatcagggtggtaacgccgacaaagctcggtccctatttagggacgcgggcttttttgtattttctagaaggaggaagactgact
ATG

    BC0439 Gene: BC0439     GI: 30018647     BI number: BC0439     GOG: COG0442     Description: Prolyl-tRNA synthetas   t t  t at        aa at       a  g cg       c  c gt        at cg        gc gc        cg ta        cg at        gt cg       c  |       tt g  a      a  |      a  t a  a      a  |       ta g  |      t  |       cg at       g  |       cg gc       g  |       cg a  a      t  |       ta a  g       gc        gc a  g       gc       |  g a  g       gc        gc at        at        cg cg       c  |       tg tg        ta        cg at        at        gc ta        at        at ta        gt        at                         ttttgtattttctagaaggaggaagactgactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0442 Prolyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................