                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:111 nt.    Distance to gene:29 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-18.90 kcal/mol
Antiterminator:    Distance from promoter:51 nt. Size=69 nt.     Delta G=-12.11 kcal/mol
Anti-antiterminator:    Distance from promoter:28 nt.    Size=44 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-AATTAT. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAACAGCCGTAGTAGTAGGTGAATTATATCGTCATGCAGGTGATTGGAAATTCAA
TGCAATCGGAAGTGGATTCCAAGGTGGATTAGCGTCTCTATGTAATAACTTTGGTTTA
GATGTAGAGTAAtagatttgatttatatatccatcggtgaaatgtatgtttactgatggatatatttttaaagataaaaatatagaggtga
atatagATG

    BC0444 Gene: BC0444     GI: 30018652     BI number: BC0444     GOG: COG2310     Description: Tellurium resistance protein ter            TT           T  G            CG            AT            AT           T  T           A  A           A  G            TA            GT            TG            AT            TA            CG            TA            CG           |  T           |  A   G       |  A A  G      |  t A  T      |  a CG       |  g        t CG       |  a      g  a TA       |  t      t  t T  T      |  t      a  g A  T      |  t       at G  A      |  g       at G  |      |  a       gt TG       |  t       ta GC       T  t       gc A  G      G  t       gt AT       C  a       cg GC       G  t       ta GT       A  a       at C  C      T  t       cg T  T       Ta        cg A  A       At        ta AT        Gc        at CG        Gc        ta GT        Ta        at TA        Gt        ta                         tttttaaagataaaaatatagaggtgaatatagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2310 Uncharacterized proteins involved in stress response, homologs of TerZ and putative cAMP-binding protein CABP1 ... can be seen here     ..................................................................................................................