Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:104 nt.    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-16.30 kcal/mol
Antiterminator:    Distance from promoter:102 nt. Size=20 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGA-TATTAT. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGATTAGTCATACACTATTCTTTATTATTTTAGTTGTAGCATTTGGAGCAACATT
TATACTTCACTACATGAAGAATTCTGGACAAGCTAGAGAAGAAGTTGCAGCTACTAAA
GAAGACAATAAATAAttgaaatgggtttgctcgttttgcgagcgcccattttttataaccaaaaatagtttataatagaagaaggactt
agaaaaaacgtaaatgtttttggaggtgaactgttGTG

    BC0446 --- BC0447


Gene: BC0446     GI: 30018654     BI number: BC0446     GOG: NOG12025     Description: hypothetical tellurium resistance protein
Gene: BC0447     GI: 30018655     BI number: BC0447     GOG: COG3853     Description: Tellurite resistance protei


            t
          t  t
          t  g
           gc
           cg
           ta
           cg
 tt        gc
t  g      t  |
 gc       t  |
 gt        tg
 gc        gc
 tg        gc
 at        gc
 at        ta
 at        at
 gt        at
            ttttataaccaaaaatagtttataatagaagaaggacttagaaaaaacgtaaatgtttttggaggtgaactgttGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[P] COG3853 Uncharacterized protein involved in tellurite resistance ... can be seen here

    ..................................................................................................................