                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:64 nt.    Distance to gene:160 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -9.40 kcal/mol
Antiterminator:    Distance from promoter:27 nt. Size=45 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -3.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTGACA-AAACGT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGACATTTATGATCATGTTATGAAACGTGAAACATTCAGCATTAGTGAAATGCAAGC
TATTACAGAAGAATTAGGTACATTAATTAAAAAGTAAaaaagcctctcttattatgaggctcttttttatttc
caacaaattcatgacaactcttctctttccctcaaccaactgtaaaatattgtacaatagaagtagaacctcaccttagattttttctccatacatacta
ctcacaaataatagcaacactaccattgctaactgtttttactggaggtgcttacttATG

    BC0448 Gene: BC0448     GI: 30018656     BI number: BC0448     GOG: COG0474     Description: Calcium-transporting ATPas   T A  G A  C A  A        A G  A      T  C TG       G  A GC        GT AT        AT TA        TA T  T       TA A  T       AT C  A       AT         a G  C      G  A      t  t A  A      A  A      t  t CG       A  A      c  a TA       G  A      t  t TA       A  A       cg A  G       CG        ta C  A       AT        cg A  A       TA        cg A  |       TA        gc AT       |  a       at GT       |  a      a  c TA       A  a       at G  G       Ta        at CG        Cg        At AT        Gc        At                         ttatttccaacaaattcatgacaactcttctctttccctcaaccaactgtaaaatattgtacaatagaagtagaacctcaccttagattttttctccatacatactactcacaaataatagcaacactaccattgctaactgtttttactggaggtgcttacttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0474 Cation transport ATPase ... can be seen here     ..................................................................................................................