                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:77 nt.    Distance to gene:129 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-19.90 kcal/mol
Antiterminator:    Distance from promoter:51 nt. Size=43 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:    Distance from promoter:20 nt.    Size=54 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGCG-TAAATT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGCGTGACAGATATCGGAGGGCGTAAATTGAAGTATGAGCCACTTTGGATTTGGTT
TACATATGTAGCTGCTCAAATGTGTATTGTATATGTGGGATTATAAaaagatactctcaaaatagt
gaatagactattttgagagtatcttttttgcttgtttaatttgatcagtattaccattttgaaatttctaatattataattttataattcagaattttgt
agaaaaatatcggttgtattatttataataaaagtaaaaagatgatgagatggtgaaATG

    BC0456 Gene: BC0456     GI: 30018664     BI number: BC0456     GOG: COG0681     Description: Signal peptidase AA A  T C  G T  T CG GT TA        aa C  |      A  a GT       A  g AT        Ta TG        At        at GT        Ta       a  a TA       T  c      g  g AT        At        ta TA        Gc        gc AT        Gt        at CG        Gc        ta AT        Ta        at TG       G  a       at TG       T  a       at TG       A  |       at |  A      T  |       cg |  T      A  |       ta |  T       Ta        cg G  A       Gt        ta GT        Ta        cg TA        Tg        at TA        At        ta Ta        Tg        at                         cttttttgcttgtttaatttgatcagtattaccattttgaaatttctaatattataattttataattcagaattttgtagaaaaatatcggttgtattatttataataaaagtaaaaagatgatgagatggtgaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG0681 Signal peptidase I ... can be seen here     ..................................................................................................................