                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-18.30 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -6.22 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -9.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGCCACAAGGGTCTTATTACCATGTCCCAAATGTGTTTACAGCATTTGATCAACCTT
TCGGTAGAGCAATCGGCACTTTTGCACCACAAACGGTATTTGTAGTTGAAGAATCTAC
AACATCATTTGGTTGGTTAAAAATTAGAACATACTTAGGAGATTCCTGGATTCGAACG
AATCGTAATTAGtaaatagattactttattccttttagaatgaagtaacaatatgttatagttccctcatatggaaaagctgtatgaggga
ttatatttttaggtcaataagacaaggagaatacgATG

    BC0471 Gene: BC0471     GI: 30018678     BI number: BC0471     GOG: COG0101     Description: tRNA pseudouridine synthase             t           a  a           a  t            cg            at            at            ta         a            gt       a  a           a  a      a  g           a  |       gc           g  |       gt            tg        tg            at        at tt        at        ta t  t       gc        at c  a      |  c       cg cg       |  c       ta ta       |  t       cg ta       a  c       cg at       t  a       cg tg       t  t      t  | ta       t  a       ta ta       t  t       gt cg        cg        at at        cg        ta ta        ta        at ta        ta        ta                         tttttaggtcaataagacaaggagaatacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0101 Pseudouridylate synthase ... can be seen here     ..................................................................................................................