                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:131 nt.     Distance to run of Ts=3 nt.   Size=19 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-11.32 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATTACGGGCGCTATCCTGTTAATATTTATAATCGTGTAATTCGTTTCATTTTAACGT
TTGTTTTACCGTTTGCGTTTGTTGGAGTATATCCAGCGGCATACTTTTTAAGAAAAAC
AGAATGGAATAGTTATGCATTTGCGACGCCAATTGTTGGTGTTATCTGTTTTACGATT
GCAATCACCCTCTGGAACCAAGGGGTAAAAAGGTATCGTGGCGCGGGTAATTAAttatag
aagcttgttcgtttctaagggataaatcagttctccacctcatacatataaaatgaggtggaggacATG

    BC0516 --- BC0517 Gene: BC0516     GI: 30018722     BI number: BC0516     GOG: COG1226     Description: LCTB protein Gene: BC0517     GI: 30018723     BI number: BC0517     GOG: COG1225     Description: Thioredoxin-dependent thiol peroxidas   A T  T G  A AT GC GC TA TG GC |  G |  G |  C |  A |  T |  A |  C |  T       TT |  T      A  T |  T       CG |  T       GC |  T      T  | |  A      A  | |  A       TG |  G       TA |  A       GC |  A      A  G TA       T  | TA       A  | TA       A  |        T GC        GC       T  G C  A       GC        AT G  |       TA        AT TG       A  A       CG TA       A  |       CG TA        GT        GT GT        AT        CG CG        CG        AT CG        AT        GT                         ATCTGTTTTACGATTGCAATCACCCTCTGGAACCAAGGGGTAAAAAGGTATCGTGGCGCGGGTAATTAAttatagaagcttgttcgtttctaagggataaatcagttctccacctcatacatataaaatgaggtggaggacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1226 Kef-type K+ transport systems, predicted NAD-binding component ... can be seen here [O] COG1225 Peroxiredoxin ... can be seen here     ..................................................................................................................