                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:121 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-25.70 kcal/mol
Antiterminator: Size=79 nt.     Delta G=-13.03 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -8.59 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAAGATTGTTGATTTTCCTTATGGAGGCTTGGAAAAGCTGGAAGAGGAAGCTGCGAAA
ACGACAGGCTTCGTTATCAATAGTCATCGCTTAGAAATTTATGGCGTTTGTCCAGAGT
GTCATAAGGCGTAAtatataataaagaaagaggctgacggctatacgtcagcctctttctttattatataaggattagcgtgaggttaat
cgggatttacagtgctaagttagtaagaagggttagataaaagtttgtcgaatttactttgtattggtggaaatgaattcttggaggggacattTTG

    BC0519 Gene: BC0519     GI: 30018725     BI number: BC0519     GOG: COG0454     Description: Ribosomal-protein-alanine acetyltransferas             C           T  C           G  A            TG            TA            TG            GT            CG            GT            GC            TA            AT            TA            TA            TG           |  G           |  C           |  G           |  T           |  A           |  A           |  t           |  a AT       |  t C  C      |  a TG       |  t GC       |  a AT       |  a |  T      |  t |  A      |  a T  G      |  a A  A      |  a A  A      A  g       ta C  A      A  a      c  t T  T      A  a      g  a A  T      G  a       gc T  T      A  g       cg TA        Ta        at GT        Tg        gc CG        Cg        ta TG        Gc        cg T  C      |  t       gc CG        Cg        gc GT        Ta        at GT       A  c       gc AT        Cg        at CG        Tg        at AT        Gc        at GC        At        gc                         tttattatataaggattagcgtgaggttaatcgggatttacagtgctaagttagtaagaagggttagataaaagtttgtcgaatttactttgtattggtggaaatgaattcttggaggggacattTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KR] COG0454 Histone acetyltransferase HPA2 and related acetyltransferases ... can be seen here     ..................................................................................................................