                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-12.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -7.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttattacctgatctagattatgCTAGCGTAGGGAAGCAATTCGGACACTAACAATGAGTCCCCGTTT
CTTTGCGTATAGAAACGGGGCTTTTTTATTTGAAAATTTCATATTGAAACCACTAGGG
GTGCTTGACTTGCTGAGAGAGGAATAATCCTTAACCCTTACAACACCTGATCTAGGTA
ATACTAGCGAAGGGAAGTGGAACATcgaataaatgtataactttatttgctgtaaccacttcttatatatagaagtggtttt
ttatttagatacatatattggaaggggatagagaaATG

    BC0742 --- BC0743 --- BC0744 --- BC0745 --- BC0746 --- BC0747 --- BC0748 --- BC0749 --- BC0750 --- BC0751 Gene: BC0742     GI: 30018901     BI number: BC0742     GOG: COG0819     Description: Transcriptional activator tenA Gene: BC0743     GI: 30018902     BI number: BC0743     GOG: COG1116     Description: Hydroxymethylpyrimidine transport ATP-binding protein Gene: BC0744     GI: 30018903     BI number: BC0744     GOG: COG0600     Description: Hydroxymethylpyrimidine transport system permease protein Gene: BC0745     GI: 30018904     BI number: BC0745     GOG: COG0715     Description: Hydroxymethylpyrimidine-binding protein Gene: BC0746     GI: 30018905     BI number: BC0746     GOG: COG0352     Description: Regulatory protein TENI Gene: BC0747     GI: 30018906     BI number: BC0747     GOG: COG0665     Description: Glycine oxidase Gene: BC0748     GI: 30018907     BI number: BC0748     GOG: COG2104     Description: ThiS protein Gene: BC0749     GI: 30018908     BI number: BC0749     GOG: COG2022     Description: Thiazole biosynthesis protein thiG Gene: BC0750     GI: 30018909     BI number: BC0750     GOG: COG0476     Description: Molybdopterin biosynthesis MoeB protein Gene: BC0751     GI: 30018910     BI number: BC0751     GOG: COG0351     Description: Phosphomethylpyrimidine kinas AA        at T  T      t  a G  A      g  a GC       t  c AT        at TA        at CG        at T  C       ta         a A  G       at       t  t G  A       at       a  a TA        gt       t  t CG        cg        ta CG       T  c       cg A  G       At        ta C  A       Cg        ta A  A       At        cg A  |      |  a       at CG       A  a       cg AT        Gc        cg TG        Gc        at TG        Ta        at                         ttttatttagatacatatattggaaggggatagagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0819 Putative transcription activator ... can be seen here [P] COG1116 ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component ... can be seen here [P] COG0600 ABC-type nitrate/sulfonate/bicarbonate transport system, permease component ... can be seen here [P] COG0715 ABC-type nitrate/sulfonate/bicarbonate transport systems, periplasmic components ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here [H] COG2104 Sulfur transfer protein involved in thiamine biosynthesis ... can be seen here [H] COG2022 Uncharacterized enzyme of thiazole biosynthesis ... can be seen here [H] COG0476 Dinucleotide-utilizing enzymes involved in molybdopterin and thiamine biosynthesis family 2 ... can be seen here [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC14579 This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:204 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-18.50 kcal/mol Antiterminator: Size=46 nt.     Delta G=-12.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttattacctgatctagattatgCTAGCGTAGGGAAGCAATTCGGACACTAACAATGAGTCCCCGTTT CTTTGCGTATAGAAACGGGGCTTTTTTATTTGAAAATTTCATATTGAAACCACTAGGG GTGCTTGACTTGCTGAGAGAGGAATAATCCTTAACCCTTACAACACCTGATCTAGGTA ATACTAGCGAAGGGAAGTGGAACATcgaataaatgtataactttatttgctgtaaccacttcttatatatagaagtggtttt ttatttagatacatatattggaaggggatagagaaATG     BC0742 --- BC0743 --- BC0744 --- BC0745 --- BC0746 --- BC0747 --- BC0748 --- BC0749 --- BC0750 --- BC0751 Gene: BC0742     GI: 30018901     BI number: BC0742     GOG: COG0819     Description: Transcriptional activator tenA Gene: BC0743     GI: 30018902     BI number: BC0743     GOG: COG1116     Description: Hydroxymethylpyrimidine transport ATP-binding protein Gene: BC0744     GI: 30018903     BI number: BC0744     GOG: COG0600     Description: Hydroxymethylpyrimidine transport system permease protein Gene: BC0745     GI: 30018904     BI number: BC0745     GOG: COG0715     Description: Hydroxymethylpyrimidine-binding protein Gene: BC0746     GI: 30018905     BI number: BC0746     GOG: COG0352     Description: Regulatory protein TENI Gene: BC0747     GI: 30018906     BI number: BC0747     GOG: COG0665     Description: Glycine oxidase Gene: BC0748     GI: 30018907     BI number: BC0748     GOG: COG2104     Description: ThiS protein Gene: BC0749     GI: 30018908     BI number: BC0749     GOG: COG2022     Description: Thiazole biosynthesis protein thiG Gene: BC0750     GI: 30018909     BI number: BC0750     GOG: COG0476     Description: Molybdopterin biosynthesis MoeB protein Gene: BC0751     GI: 30018910     BI number: BC0751     GOG: COG0351     Description: Phosphomethylpyrimidine kinas   C A  A A  A T  T C  G A  A CG AT        CG GC       G  T GC       T  A C  C      T  T T  C       TA T  |       CG A  |       TA A  |       TA CG        TA GT        GC AT        CG AT        CG GC        CG GT        CG GT       T  | AT        GC TG        AT GC        GT             TTTTATTTGAAAATTTCATATTGAAACCACTAGGGGTGCTTGACTTGCTGAGAGAGGAATAATCCTTAACCCTTACAACACCTGATCTAGGTAATACTAGCGAAGGGAAGTGGAACATcgaataaatgtataactttatttgctgtaaccacttcttatatatagaagtggttttttatttagatacatatattggaaggggatagagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0819 Putative transcription activator ... can be seen here [P] COG1116 ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component ... can be seen here [P] COG0600 ABC-type nitrate/sulfonate/bicarbonate transport system, permease component ... can be seen here [P] COG0715 ABC-type nitrate/sulfonate/bicarbonate transport systems, periplasmic components ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here [H] COG2104 Sulfur transfer protein involved in thiamine biosynthesis ... can be seen here [H] COG2022 Uncharacterized enzyme of thiazole biosynthesis ... can be seen here [H] COG0476 Dinucleotide-utilizing enzymes involved in molybdopterin and thiamine biosynthesis family 2 ... can be seen here [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................