Gene putatively regulated by attenuation in B_cereus_ATCC14579

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:169 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -6.90 kcal/mol
Antiterminator: Size=69 nt.     Delta G=-14.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgataaatttctctgcatttatcaattggggctgttttcgaatagaaacagaactgtcatatgtacagacgtgtacgtatgaagagctatctacaaaaa
agagatatcattttttatgatattccttttttggcggtttttttattagctccgttttctgtttcccttttcctgtaacagcaccatcctcacttatttg
agatggtgttttttgtttgtctttctggtaactacaggagtattgggattgatatatttcctaatctattcttaaaaatagacgaaagaaggaatttgta
ATG

    BC1748


Gene: BC1748     GI: 30019892     BI number: BC1748     GOG: COG0527     Description: Aspartokinas


 ac
g  g
 at
 cg
 at
 ta
 gc
 tg
 at
 ta
 at
 cg
 ta
g  |
 ta
 cg
a  a
a  g
 gc
 at
c  a
a  |
a  |
 at
 gc         t
 at       t  t
 ta       t  t
|  c       ta
|  a       at
|  a       cg
|  a       ta
a  a       at
a  a       ta
g  a       at
 cg       g  t
 ta       a  c
 tg        gc
 ta        at
            tttttggcggtttttttattagctccgttttctgtttcccttttcctgtaacagcaccatcctcacttatttgagatggtgttttttgtttgtctttctggtaactacaggagtattgggattgatatatttcctaatctattcttaaaaatagacgaaagaaggaatttgtaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0527 Aspartokinases ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Lysine_riboswitch sequence ... can be seen here

    ..................................................................................................................