                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:161 nt.    Distance to gene:60 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-10.90 kcal/mol
Antiterminator:    Distance from promoter:103 nt. Size=71 nt.     Delta G=-22.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tatgat. It has a score value of 76.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacagtttcacgaagtatgctatgatgaatacattataaaaacaaaatattcatccactaggggggccttttataggctgagatcaaatgtgattttg
agactcttagtacctgatctggttaatgccagcgtagggaagtgggaaagacgttgctatttaatgagtaaataaatactgtcaatttcactttctttac
gcctgtaaagaaagtttttttattttacagctttaataattgtggataaatacttatattttatacattattggagggatttaaATG

    BC2551 Gene: BC2551     GI: 30020678     BI number: BC2551     GOG: COG0819     Description: Transcriptional activator ten   g t  a a  g at ta ta ta at ta c  a g  a t  t ta gc |  t cg at gc a  a a  a at gt gt gc ta        cc gc       g  t |  t       cg at        at at        ta gc        ta gt        ta gt        cg at        ta ta        ta gc        ta cg        cg gc        at             ttttttattttacagctttaataattgtggataaatacttatattttatacattattggagggatttaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0819 Putative transcription activator ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC14579 This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:163 nt.    Distance to gene:67 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.60 kcal/mol Antiterminator:    Distance from promoter:126 nt. Size=71 nt.     Delta G=-22.60 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgaca-tatgat. It has a score value of 76.97 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgacagtttcacgaagtatgctatgatgaatacattataaaaacaaaatattcatccactaggggggccttttataggctgagatcaaatgtgattttg agactcttagtacctgatctggttaatgccagcgtagggaagtgggaaagacgttgctatttaatgagtaaataaatactgtcaatttcactttctttac gcctgtaaagaaagtttttttattttacagctttaataattgtggataaatacttatattttatacattattggagggatttaaATG     BC2551 Gene: BC2551     GI: 30020678     BI number: BC2551     GOG: COG0819     Description: Transcriptional activator ten   c t  a t  c tt at at cc tt gt t  t c  a a  c tg ac |  c at a t a a a t g a g t |         cc a       g  t a        cg t        at t        ta t        ta a        ta t        cg c        ta g        ta t        ta             gtttttttattttacagctttaataattgtggataaatacttatattttatacattattggagggatttaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0819 Putative transcription activator ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................