Gene putatively regulated by attenuation in B_cereus_ATCC14579

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:120 nt.    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-11.14 kcal/mol
Antiterminator:    Distance from promoter:94 nt. Size=48 nt.     Delta G=-10.12 kcal/mol
Anti-antiterminator:    Distance from promoter:61 nt.    Size=55 nt.     Delta G= -8.72 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-tatatt. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaaggaaaagttgccgaagtttatatttcttctctggaaatatgagctggggctgtctccgaaaggaacagaactgtcacgtttacaaaattaccgt
gtaaacgtggggtgctatcttaacggaagggtatgatggggtggttatttgtgaaacgttccgccaaattcctttggcggttttttgtatttttctcccc
cgctccttcctaacctacaagaaaaggaGTG

    BC3052 --- BC3053 --- BC3054


Gene: BC3052     GI: 30021167     BI number: BC3052     GOG: COG0833     Description: Lysine-specific permease
Gene: BC3053     GI: 30021168     BI number: BC3053     GOG: -------     Description: HesB-like protein
Gene: BC3054     GI: 30021169     BI number: BC3054     GOG: COG4335     Description: IG hypothetical 1863


 ct
g  a
t  t
 gc         t
 gt       t  g
g  t      t  t
g  a      a  g
 ta       t  a
 gc       t  a
 cg       g  a
|  g       gc
|  a       tg        tc
|  a      g  t      t  c
|  g      g  t       at
|  g       gc        at
|  g       gc        at
|  t      t  |       cg
a  a      a  |       cg
a  t      g  |       gc
a  g      t  |       cg
 ta       a  |       cg
 gt        tg       t  t
 tg        gc       t  t
g  g       gc       g  t
 cg       |  a      c  t
 cg       |  a      a  t
 at       g  a      a  t
 tg        at       a  g
 tg        at        gt
 at        gc        ta
 at        gc        gt
                        ttttctcccccgctccttcctaacctacaagaaaaggaGTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0833 Amino acid transporters ... can be seen here
[L] COG4335 DNA alkylation repair enzyme ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Lysine_riboswitch sequence ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC14579

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:130 nt.    Distance to gene:42 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-11.00 kcal/mol
Antiterminator:    Distance from promoter:92 nt. Size=48 nt.     Delta G=-10.12 kcal/mol
Anti-antiterminator:    Distance from promoter:83 nt.    Size=32 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-tatatt. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaaggaaaagttgccgaagtttatatttcttctctggaaatatgagctggggctgtctccgaaaggaacagaactgtcacgtttacaaaattaccgt
gtaaacgtggggtgctatcttaacggaagggtatgatggggtggttatttgtgaaacgttccgccaaattcctttggcggttttttgtatttttctcccc
cgctccttcctaacctacaagaaaaggaGTG

    BC3052 --- BC3053 --- BC3054


Gene: BC3052     GI: 30021167     BI number: BC3052     GOG: COG0833     Description: Lysine-specific permease
Gene: BC3053     GI: 30021168     BI number: BC3053     GOG: -------     Description: HesB-like protein
Gene: BC3054     GI: 30021169     BI number: BC3054     GOG: COG4335     Description: IG hypothetical 1863


            t
          a  t
          t  t
          t  g
          g  t
          g  g
          t  a
           ga
           ga
          g  c
          g  g
           tt
 gg        at
a  g      g  |
a  t      t  |
g  a      a  |
 gt       t  |
 cg       g  |
a  a       gc        tc
 at        gc       t  c
 tg        ag        at
 tg       |  c       at
 cg       |  c       at
 tg       a  a       cg
 at        ga        cg
 tg        ga        gc
 cg        ct        cg
 gt        at        cg
                        ttttttgtatttttctcccccgctccttcctaacctacaagaaaaggaGTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0833 Amino acid transporters ... can be seen here
[L] COG4335 DNA alkylation repair enzyme ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Lysine_riboswitch sequence ... can be seen here

    ..................................................................................................................