Gene putatively regulated by attenuation in B_cereus_ATCC14579

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:139 nt.    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-18.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaat-tatact. It has a score value of 76.97 and is shown in blue

tttaattttctatacttattttttatactgaaataaaaagagacaactagcgtttaaaaattcgatattttgctaggttttttccttatgcagaaatatc
aattatcgttaggtttctttcctatgctttcgtattcaaactatatttctagaaatcacgtctcccaaaccccaaggatattaaatccttggggttttTT
G

    BC4109 --- BC4110 --- BC4111 --- BC4112


Gene: BC4109     GI: 30022196     BI number: BC4109     GOG: COG0117,COG1985     Description: Diaminohydroxyphosphoribosylaminopyrimidine deaminase
Gene: BC4110     GI: 30022197     BI number: BC4110     GOG: COG0307     Description: Riboflavin synthase alpha chain
Gene: BC4111     GI: 30022198     BI number: BC4111     GOG: COG0108,COG0807     Description: GTP cyclohydrolase II
Gene: BC4112     GI: 30022199     BI number: BC4112     GOG: COG0054     Description: 6,7-dimethyl-8-ribityllumazine synthas


           t
         t  a
         a  a
          ta
          at
          gc
          gc
          at
          at
          cg
          cg
          cg
          cg
          at
            tttTTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[H] COG0117 Pyrimidine deaminase ... can be seen here
[H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here
[H] COG0307 Riboflavin synthase alpha chain ... can be seen here
[H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here
[H] COG0807 GTP cyclohydrolase II ... can be seen here
[H] COG0054 Riboflavin synthase beta-chain ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Riboflavin_riboswitch sequence ... can be seen here

    ..................................................................................................................